src/hg/encode/validateFiles/validateFiles.c 1.5
1.5 2009/03/13 16:39:21 mikep
making everythign use linefile so .gz/.bzip2 files handled automatically
Index: src/hg/encode/validateFiles/validateFiles.c
===================================================================
RCS file: /projects/compbio/cvsroot/kent/src/hg/encode/validateFiles/validateFiles.c,v
retrieving revision 1.4
retrieving revision 1.5
diff -b -B -U 1000000 -r1.4 -r1.5
--- src/hg/encode/validateFiles/validateFiles.c 13 Mar 2009 08:22:13 -0000 1.4
+++ src/hg/encode/validateFiles/validateFiles.c 13 Mar 2009 16:39:21 -0000 1.5
@@ -1,564 +1,558 @@
/* validateFiles - validate format of different track input files. */
#include "common.h"
#include "linefile.h"
#include "hash.h"
#include "options.h"
#include "sqlNum.h"
#include "chromInfo.h"
static char const rcsid[] = "$Id$";
static char *version = "$Revision$";
#define MAX_ERRORS 10
int maxErrors;
boolean zeroSizeOk;
boolean printOkLines;
boolean printFailLines;
struct hash *chrHash = NULL;
char dnaChars[256];
char qualChars[256];
char seqName[256];
char digits[256];
char alpha[256];
char csSeqName[256];
void usage()
/* Explain usage and exit. */
{
errAbort(
"validateFiles - validate format of different track input files\n"
"usage:\n"
" validateFiles -type=FILE_TYPE file1 [file2 [...]]\n"
"options:\n"
" -type=(fastq|csfasta|tagAlign|pairedTagAlign)\n"
" csfasta = Colorspace fasta (SOLiD platform)\n"
" -chromInfo=file.txt Specify chromInfo file to validate chrom names and sizes\n"
" -maxErrors=N Maximum lines with errors to report in one file before \n"
" stopping (default %d)\n"
" -zeroSizeOk For BED-type positional data, allow rows with start==end\n"
" otherwise require start < end\n"
" -printOkLines Print lines which pass validation to stdout\n"
" -printFailLines Print lines which fail validation to stdout\n"
" -version Print version\n"
, MAX_ERRORS);
}
static struct optionSpec options[] = {
{"type", OPTION_STRING},
{"chromInfo", OPTION_STRING},
{"maxErrors", OPTION_INT},
{"zeroSizeOk", OPTION_BOOLEAN},
{"printOkLines", OPTION_BOOLEAN},
{"printFailLines", OPTION_BOOLEAN},
{"version", OPTION_BOOLEAN},
{NULL, 0},
};
void initArrays()
// Set up array of chars
// dnaChars: or DNA chars include colorspace 0-3 as valid dna sequences for SOLiD data
// qualChars: fastq quality scores as ascii [!-~] (ord(!)=33, ord(~)=126)
// seqName: fastq sequence name chars [A-Za-z0-9_.:/-]
{
int i;
for (i=0 ; i < 256 ; ++i)
dnaChars[i] = qualChars[i] = seqName[i] = csSeqName[i] = digits[i] = alpha[i] = 0;
dnaChars['a'] = dnaChars['c'] = dnaChars['g'] = dnaChars['t'] = dnaChars['n'] = 1;
dnaChars['A'] = dnaChars['C'] = dnaChars['G'] = dnaChars['T'] = dnaChars['N'] = 1;
dnaChars['0'] = dnaChars['1'] = dnaChars['2'] = dnaChars['3'] = 1;
for (i= (int)'A' ; i <= (int)'Z' ; ++i)
seqName[i] = seqName[i+(int)('a'-'A')] = alpha[i] = alpha[i+(int)('a'-'A')] = 1;
for (i= (int)'0' ; i <= (int)'9' ; ++i)
seqName[i] = digits[i] = csSeqName[i] = 1;
seqName['_'] = seqName['.'] = seqName[':'] = seqName['/'] = seqName['-'] = 1;
csSeqName[','] = csSeqName['.'] = csSeqName['-'] = csSeqName['#'] = 1;
for (i= (int)'!' ; i <= (int)'~' ; ++i)
qualChars[i] = 1;
}
struct hash *chromHash(struct chromInfo *ci)
// Return a hash table of chrom name to chrom size
{
unsigned *size;
struct hash *h = newHash(0);
for ( ; ci ; ci = ci->next )
{
AllocVar(size);
*size = ci->size;
verbose(3,"[%s %3d] hashAdd(%s -> %p = %u)\n", __func__, __LINE__, ci->chrom, size, *size);
hashAdd(h, ci->chrom, size);
}
return h;
}
boolean checkString(char *file, int line, char *row, char *s, char *name)
// Return TRUE if string has non-zero length
// Othewise print warning that name column is empty and return FALSE
{
if (strlen(s) > 0)
{
verbose(2,"[%s %3d] %s(%s)\n", __func__, __LINE__, name, s);
return TRUE;
}
warn("Error [file=%s, line=%d]: %s column empty [%s]", file, line, name, row);
return FALSE;
}
boolean checkChrom(char *file, int line, char *row, char *s, unsigned *chromSize)
// Return TRUE if string has non-zero length
// Othewise print warning that name column is empty and return FALSE
{
unsigned *size;
*chromSize = 0;
if (strlen(s) > 0)
{
if (chrHash)
{
if ( (size = hashFindVal(chrHash, s)) != NULL)
{
*chromSize = *size;
verbose(2,"[%s %3d] hashFindVal(%s -> %p = %u)\n", __func__, __LINE__, s, size, *size);
return TRUE; // found chrom
}
else
{
warn("Error [file=%s, line=%d]: chrom %s not found [%s]", file, line, s, row);
return FALSE; // chrom not found
}
}
else
{
verbose(2,"[%s %3d] chrom(%s) \n", __func__, __LINE__, s);
return TRUE; // chrom name not blank, and not validating against chromInfo
}
}
warn("Error [file=%s, line=%d]: chrom column empty [%s]", file, line, row);
return FALSE;
}
boolean checkSeq(char *file, int line, char *row, char *s, char *name)
// Return TRUE if string has non-zero length and contains only chars [ACGTNacgtn0-3]
// Othewise print warning that name column is empty and return FALSE
{
int i;
for ( i = 0; s[i] ; ++i)
{
if (!dnaChars[(int)s[i]])
{
warn("Error [file=%s, line=%d]: invalid DNA chars in %s(%s) [%s]", file, line, name, s, row);
return FALSE;
}
}
if (i == 0)
{
warn("Error [file=%s, line=%d]: %s column empty [%s]", file, line, name, row);
return FALSE;
}
return TRUE;
}
boolean checkSeqName(char *file, int line, char *s, char firstChar, char *name)
// Return TRUE if string has non-zero length and contains only seqName[] chars
// Othewise print warning that seqName is empty and return FALSE
{
int i;
if (s[0] == 0)
{
warn("Error [file=%s, line=%d]: %s empty [%s]", file, line, name, s);
return FALSE;
}
else if (s[0] != firstChar)
{
warn("Error [file=%s, line=%d]: %s first char invalid (got '%c', wanted '%c') [%s]",
file, line, name, s[0], firstChar, s);
return FALSE;
}
for ( i = 1; s[i] ; ++i)
{
if (!seqName[(int)s[i]])
{
warn("Error [file=%s, line=%d]: invalid %s chars in [%s]", file, line, name, s);
return FALSE;
}
}
return TRUE;
}
char *getDigits(char *s)
// Consume 1 or more digits from s, return pointer to next non-digit
// Return NULL if no digits consumed
{
char *s0 = s;
while (digits[(int) *s])
++s;
if (s > s0)
return s;
else
return NULL;
}
boolean checkTrailingCsSeqName(char *s)
// Return true if all chars in s (if any) are csSeqName chars
// Return false otherwise
{
while (csSeqName[(int) *s])
++s;
if (*s == 0)
return TRUE;
else
return FALSE;
}
// >461_19_209_F3
// T022213002230311203200200322000
// >920_22_656_F3,1.-152654094.1.35.35.0###,19.43558664.1.35.35.0###
// T01301010111200210102321210100112312
boolean checkCsSeqName(char *file, int line, char *s)
// Return TRUE if string has non-zero length, matches CS name pattern contains only csSeqName[] chars
// Othewise print warning that seqName is empty and return FALSE
{
char *s0;
if (s[0] == 0)
{
warn("Error [file=%s, line=%d]: sequence name empty [%s]", file, line, s);
return FALSE;
}
else if (s[0] != '>')
{
warn("Error [file=%s, line=%d]: sequence name first char invalid (got '%c', wanted '>') [%s]",
file, line, s[0], s);
return FALSE;
}
if ( (s0 = getDigits(s+1))
&& (*(s0++) == '_')
&& (s0 = getDigits(s0)) && (*(s0++) == '_')
&& (s0 = getDigits(s0)) && (*(s0++) == '_')
&& alpha[(int) *(s0++)] && digits[(int) *(s0++)]
&& checkTrailingCsSeqName(s0) )
{
verbose(2,"[%s %3d] OK [%s] file(%s) line=%d\n", __func__, __LINE__, s, file, line);
return TRUE;
}
else
{
warn("Error [file=%s, line=%d]: invalid sequence name [%s]", file, line, s);
return FALSE;
}
}
boolean checkQual(char *file, int line, char *s)
// Return TRUE if string has non-zero length and contains only qualChars[] chars
// Othewise print warning that quality is empty and return FALSE
{
int i;
for ( i = 0; s[i] ; ++i)
{
if (!qualChars[(int)s[i]])
{
warn("Error [file=%s, line=%d]: invalid quality chars in [%s]", file, line, s);
return FALSE;
}
}
if (i == 0)
{
warn("Error [file=%s, line=%d]: quality empty [%s]", file, line, s);
return FALSE;
}
return TRUE;
}
boolean checkStartEnd(char *file, int line, char *row, char *start, char *end, char *chrom, unsigned chromSize)
// Return TRUE if start and end are both >= 0,
// and if zeroSizeOk then start <= end
// otherwise then start < end
// Othewise print warning and return FALSE
{
unsigned s = sqlUnsigned(start);
unsigned e = sqlUnsigned(end);
verbose(2,"[%s %3d] inputLine=%d [%s..%s] -> [%u..%u] (chrom=%s,size=%u) [%s]\n", __func__, __LINE__, line, start, end, s, e, chrom, chromSize, row);
if (chromSize > 0)
{
if (e > chromSize)
{
warn("Error [file=%s, line=%d]: end(%u) > chromSize(%s=%u) [%s]", file, line, e, chrom, chromSize, row);
return FALSE;
}
else
verbose(2,"[%s %3d] end <= chromSize (%u <= %u)\n", __func__, __LINE__, e, chromSize);
}
if (zeroSizeOk)
{
if (s <= e)
{
verbose(2,"[%s %3d] start <= end (%u <= %u)\n", __func__, __LINE__, s, e);
return TRUE;
}
else
warn("Error [file=%s, line=%d]: start(%u) > end(%u) [%s]", file, line, s, e, row);
}
else
{
if (s < e)
{
verbose(2,"[%s %3d] start < end (%u < %u)\n", __func__, __LINE__, s, e);
return TRUE;
}
else
warn("Error [file=%s, line=%d]: start(%u) >= end(%u) [%s]", file, line, s, e, row);
}
return FALSE;
}
boolean checkIntBetween(char *file, int line, char *row, char *val, char *name, int min, int max)
// Return TRUE if val is integer between min and max
// Othewise print warning and return FALSE
{
int i = sqlSigned(val);
verbose(2,"[%s %3d] inputLine=%d [%s] -> [%d] [%s,%d..%d]\n", __func__, __LINE__, line, val, i, name, min, max);
if (i >= min && i <= max)
{
verbose(2,"[%s %3d] min <= value <= max (%d <= %d <= %d)\n", __func__, __LINE__, min, i, max);
return TRUE;
}
warn("Error [file=%s, line=%d]: %s %d outside bounds (%d, %d) [%s]", file, line, name, i, min, max, row);
return FALSE;
}
boolean checkStrand(char *file, int line, char *row, char *strand)
// Return TRUE if strand == '+' or '-',
// Othewise print warning and return FALSE
{
if (strlen(strand) == 1 && (*strand == '+' || *strand == '-' || *strand == '.'))
{
verbose(2,"[%s %3d] strand(%s)\n", __func__, __LINE__, strand);
return TRUE;
}
warn("Error [file=%s, line=%d]: invalid strand '%s' (want '+','-','.') [%s]", file, line, strand, row);
return FALSE;
}
-int validateTagOrPairedTagAlign(char *file, boolean paired)
+int validateTagOrPairedTagAlign(struct lineFile *lf, char *file, boolean paired)
{
char *row;
char buf[1024];
char *words[9];
-struct lineFile *lf = lineFileOpen(file, TRUE);
int line = 0;
int errs = 0;
unsigned chromSize;
+int size;
verbose(2,"[%s %3d] paired=%d file(%s)\n", __func__, __LINE__, paired, file);
-while (lineFileNextReal(lf, &row))
+while (lineFileNext(lf, &row, &size))
{
++line;
safecpy(buf, sizeof(buf), row);
int n = chopByWhite(buf, words, 9);
if ( n != (paired ? 8 : 6))
errAbort("Error: found %d columns, expected %d [%s]\n", n, (paired ? 8 : 6), row);
if (checkChrom(file, line, row, words[0], &chromSize)
&& checkStartEnd(file, line, row, words[1], words[2], words[0], chromSize)
&& checkIntBetween(file, line, row, words[4], "score", 0, 1000)
&& checkStrand(file, line, row, words[5])
&& (paired ?
(checkString(file, line, row, words[3], "name")
&& checkSeq(file, line, row, words[6], "seq1")
&& checkSeq(file, line, row, words[7], "seq2"))
:
checkSeq(file, line, row, words[3], "sequence")
) )
{
if (printOkLines)
printf("%s\n", row);
}
else
{
if (printFailLines)
printf("%s\n", row);
if (++errs >= maxErrors)
errAbort("Aborting .. found %d errors\n", errs);
}
}
-lineFileClose(&lf);
return errs;
}
// tagAlign
// chr1 6082 6117 TCTACTGGCTCTGTGTGTACCAGTCTGTCACTGAG 1000 -
// chr1 7334 7369 AGCCAGGGGGTGACGTTGTTAGATTAGATTTCTTA 1000 +
-int validateTagAlign(char *file)
+int validateTagAlign(struct lineFile *lf, char *file)
{
-return validateTagOrPairedTagAlign(file, FALSE);
+return validateTagOrPairedTagAlign(lf, file, FALSE);
}
// pairedTagAlign
// chr10 96316360 96310862 9 1000 + TCTCACCCGATAACGACCCCCTCCC TGATCCTTGACTCACTTGCTAATTT
// chr8 126727657 126721865 10 1000 + AATTCTTCACCTCTCCTGTTCAAAG TGTGTGAGATCCAAGAATCCTCTCT
-int validatePairedTagAlign(char *file)
+int validatePairedTagAlign(struct lineFile *lf, char *file)
{
-return validateTagOrPairedTagAlign(file, TRUE);
+return validateTagOrPairedTagAlign(lf, file, TRUE);
}
// fastq:
// @NINA_1_FC30G3VAAXX:5:1:110:908
// ATCGTCAGGTGGGATAATCCTTACCTTTTCCTCCTC
// +NINA_1_FC30G3VAAXX:5:1:110:908
// aa`]`a`XQ^VQQ^`aaaaaaa^[[ZG[aXUX[[[X
-int validateFastq(char *file)
+int validateFastq(struct lineFile *lf, char *file)
{
-char *seqName = NULL;
-char *seq = NULL;
-char *qName = NULL;
-char *qual = NULL;
+char *seqName, *seq, *qName, *qual;
int line = 0;
int errs = 0;
boolean startOfFile = TRUE;
-FILE *f = mustOpen(file, "rb");
verbose(2,"[%s %3d] file(%s)\n", __func__, __LINE__, file);
-while ( (seqName = readLine(f)) )
+while ( lineFileNext(lf, &seqName, NULL))
{
++line;
if (startOfFile)
{
if (*seqName == '#')
- {
- freez(&seqName);
continue;
- }
else
startOfFile = FALSE;
}
if (checkSeqName(file, line, seqName, '@', "sequence name")
- && (seq = readLine(f))
+ && (lineFileNext(lf, &seq, NULL))
&& checkSeq(file, ++line, seq, seq, "sequence")
- && (qName = readLine(f))
+ && (lineFileNext(lf, &qName, NULL))
&& checkSeqName(file, ++line, qName, '+', "quality name")
- && (qual = readLine(f))
+ && (lineFileNext(lf, &qual, NULL))
&& checkQual(file, ++line, qual) )
{
if (printOkLines)
printf("%s\n%s\n%s\n%s\n", seqName, seq, qName, qual);
}
else
{
if (printFailLines)
printf("%s\n%s\n%s\n%s\n", seqName, seq, qName, qual);
if (++errs >= maxErrors)
errAbort("Aborting .. found %d errors\n", errs);
}
- freez(&seqName);
- freez(&seq);
- freez(&qName);
- freez(&qual);
}
-carefulClose(&f);
return errs;
}
// CS Fasta:
// >461_19_209_F3
// T022213002230311203200200322000
// >920_22_656_F3,1.-152654094.1.35.35.0###,19.43558664.1.35.35.0###
// T01301010111200210102321210100112312
-int validateCsfasta(char *file)
+int validateCsfasta(struct lineFile *lf, char *file)
{
char *seqName = NULL;
char *seq = NULL;
int line = 0;
int errs = 0;
boolean startOfFile = TRUE;
-FILE *f = mustOpen(file, "rb");
verbose(2,"[%s %3d] file(%s)\n", __func__, __LINE__, file);
-while ( (seqName = readLine(f)) )
+while (lineFileNext(lf, &seqName, NULL))
{
++line;
if (startOfFile)
{
if (*seqName == '#')
- {
- freez(&seqName);
continue;
- }
else
startOfFile = FALSE;
}
if (checkCsSeqName(file, line, seqName)
- && (seq = readLine(f))
+ && (lineFileNext(lf, &seq, NULL))
&& checkSeq(file, ++line, seq, seq, "sequence") )
{
if (printOkLines)
printf("%s\n%s\n", seqName, seq);
}
else
{
if (printFailLines)
printf("%s\n%s\n", seqName, seq);
if (++errs >= maxErrors)
errAbort("Aborting .. found %d errors\n", errs);
}
- freez(&seqName);
- freez(&seq);
}
-carefulClose(&f);
return errs;
}
-void validateFiles(int (*validate)(char *file), int numFiles, char *files[])
+void validateFiles(int (*validate)(struct lineFile *lf, char *file), int numFiles, char *files[])
/* validateFile - validate format of different track input files. */
{
int i;
int errs = 0;
verbose(2,"[%s %3d] numFiles=%d \n", __func__, __LINE__, numFiles);
for (i = 0; i < numFiles ; ++i)
{
- errs += validate(files[i]);
+ struct lineFile *lf = lineFileOpen(files[i], TRUE);
+ errs += validate(lf, files[i]);
+ lineFileClose(&lf);
}
verbose(2,"[%s %3d] done loop\n", __func__, __LINE__);
if (errs > 0)
errAbort("Aborting ... found %d errors in total\n", errs);
verbose(2,"[%s %3d] done\n", __func__, __LINE__);
}
+int testFunc(char *f)
+{
+char *row;
+int size;
+struct lineFile *lf = lineFileOpen(f, TRUE);
+while (lineFileNext(lf, &row, &size))
+ printf("size=%d [%s]\n", size, row);
+printf("done.\n");
+return 0;
+}
+
int main(int argc, char *argv[])
/* Process command line. */
{
char *type;
void *func;
struct chromInfo *ci = NULL;
struct hash *funcs = newHash(0);
optionInit(&argc, argv, options);
++argv;
--argc;
initArrays();
if (optionExists("version"))
errAbort(version);
if (argc==0)
usage();
type = optionVal("type", "");
if (strlen(type) == 0)
errAbort("please specify type");
maxErrors = optionInt("maxErrors", MAX_ERRORS);
zeroSizeOk = optionExists("zeroSizeOk");
printOkLines = optionExists("printOkLines");
printFailLines = optionExists("printFailLines");
if (strlen(optionVal("chromInfo", "")) > 0)
{
if (!(ci = chromInfoLoadAll(optionVal("chromInfo", ""))))
errAbort("could not load chromInfo file %s\n", optionVal("chromInfo", ""));
chrHash = chromHash(ci);
chromInfoFree(&ci);
}
verbose(2,"[%s %3d] type=%s\n", __func__, __LINE__, type);
// Setup the function hash keyed by type
hashAdd(funcs, "tagAlign", &validateTagAlign);
hashAdd(funcs, "pairedTagAlign", &validatePairedTagAlign);
hashAdd(funcs, "fastq", &validateFastq);
hashAdd(funcs, "csfasta", &validateCsfasta);
+//hashAdd(funcs, "test", &testFunc);
if (!(func = hashFindVal(funcs, type)))
errAbort("Cannot validate %s type files\n", type);
validateFiles(func, argc, argv);
return 0;
}