src/hg/encode/validateFiles/validateFiles.c 1.5

1.5 2009/03/13 16:39:21 mikep
making everythign use linefile so .gz/.bzip2 files handled automatically
Index: src/hg/encode/validateFiles/validateFiles.c
===================================================================
RCS file: /projects/compbio/cvsroot/kent/src/hg/encode/validateFiles/validateFiles.c,v
retrieving revision 1.4
retrieving revision 1.5
diff -b -B -U 1000000 -r1.4 -r1.5
--- src/hg/encode/validateFiles/validateFiles.c	13 Mar 2009 08:22:13 -0000	1.4
+++ src/hg/encode/validateFiles/validateFiles.c	13 Mar 2009 16:39:21 -0000	1.5
@@ -1,564 +1,558 @@
 /* validateFiles - validate format of different track input files. */
 #include "common.h"
 #include "linefile.h"
 #include "hash.h"
 #include "options.h"
 #include "sqlNum.h"
 #include "chromInfo.h"
 
 static char const rcsid[] = "$Id$";
 static char *version = "$Revision$";
 
 #define MAX_ERRORS 10
 int maxErrors;
 boolean zeroSizeOk;
 boolean printOkLines;
 boolean printFailLines;
 struct hash *chrHash = NULL;
 char dnaChars[256];
 char qualChars[256];
 char seqName[256];
 char digits[256];
 char alpha[256];
 char csSeqName[256];
 
 void usage()
 /* Explain usage and exit. */
 {
 errAbort(
   "validateFiles - validate format of different track input files\n"
   "usage:\n"
   "   validateFiles -type=FILE_TYPE file1 [file2 [...]]\n"
   "options:\n"
   "   -type=(fastq|csfasta|tagAlign|pairedTagAlign)\n"
   "                                csfasta = Colorspace fasta (SOLiD platform)\n"
   "   -chromInfo=file.txt          Specify chromInfo file to validate chrom names and sizes\n"
   "   -maxErrors=N                 Maximum lines with errors to report in one file before \n"
   "                                  stopping (default %d)\n"
   "   -zeroSizeOk                  For BED-type positional data, allow rows with start==end\n"
   "                                  otherwise require start < end\n"
   "   -printOkLines                Print lines which pass validation to stdout\n"
   "   -printFailLines              Print lines which fail validation to stdout\n"
   "   -version                     Print version\n"
   , MAX_ERRORS);
 }
 
 static struct optionSpec options[] = {
    {"type", OPTION_STRING},
    {"chromInfo", OPTION_STRING},
    {"maxErrors", OPTION_INT},
    {"zeroSizeOk", OPTION_BOOLEAN},
    {"printOkLines", OPTION_BOOLEAN},
    {"printFailLines", OPTION_BOOLEAN},
    {"version", OPTION_BOOLEAN},
    {NULL, 0},
 };
 
 void initArrays()
 // Set up array of chars
 // dnaChars:  or DNA chars include colorspace 0-3 as valid dna sequences for SOLiD data
 // qualChars: fastq quality scores as ascii [!-~] (ord(!)=33, ord(~)=126)
 // seqName:   fastq sequence name chars [A-Za-z0-9_.:/-]
 {
 int i;
 for (i=0 ; i < 256 ; ++i)
     dnaChars[i] = qualChars[i] = seqName[i] = csSeqName[i] = digits[i] = alpha[i] = 0;
 dnaChars['a'] = dnaChars['c'] = dnaChars['g'] = dnaChars['t'] = dnaChars['n'] = 1;
 dnaChars['A'] = dnaChars['C'] = dnaChars['G'] = dnaChars['T'] = dnaChars['N'] = 1;
 dnaChars['0'] = dnaChars['1'] = dnaChars['2'] = dnaChars['3'] = 1;
 for (i= (int)'A' ; i <= (int)'Z' ; ++i)
     seqName[i] = seqName[i+(int)('a'-'A')] = alpha[i] = alpha[i+(int)('a'-'A')] = 1;
 for (i= (int)'0' ; i <= (int)'9' ; ++i)
     seqName[i] = digits[i] = csSeqName[i] = 1;
 seqName['_'] = seqName['.'] = seqName[':'] = seqName['/'] = seqName['-'] = 1;
 csSeqName[','] = csSeqName['.'] = csSeqName['-'] = csSeqName['#'] = 1;
 for (i= (int)'!' ; i <= (int)'~' ; ++i)
     qualChars[i] = 1;
 }
 
 struct hash *chromHash(struct chromInfo *ci)
 // Return a hash table of chrom name to chrom size
 {
 unsigned *size;
 struct hash *h = newHash(0);
 for ( ; ci ; ci = ci->next )
     {
     AllocVar(size);
     *size = ci->size;
     verbose(3,"[%s %3d] hashAdd(%s -> %p = %u)\n", __func__, __LINE__, ci->chrom, size, *size);
     hashAdd(h, ci->chrom, size);
     }
 return h;
 }
 
 boolean checkString(char *file, int line, char *row, char *s, char *name)
 // Return TRUE if string has non-zero length
 // Othewise print warning that name column is empty and return FALSE
 {
 if (strlen(s) > 0)
     {
     verbose(2,"[%s %3d] %s(%s)\n", __func__, __LINE__, name, s);
     return TRUE;
     }
 warn("Error [file=%s, line=%d]: %s column empty [%s]", file, line, name, row);
 return FALSE;
 }
 
 boolean checkChrom(char *file, int line, char *row, char *s, unsigned *chromSize)
 // Return TRUE if string has non-zero length
 // Othewise print warning that name column is empty and return FALSE
 {
 unsigned *size;
 *chromSize = 0;
 if (strlen(s) > 0)
     {
     if (chrHash)
 	{
 	if ( (size = hashFindVal(chrHash, s)) != NULL)
 	    {
 	    *chromSize = *size;
 	    verbose(2,"[%s %3d] hashFindVal(%s -> %p = %u)\n", __func__, __LINE__, s, size, *size);
 	    return TRUE; // found chrom
 	    }
 	else
 	    {
 	    warn("Error [file=%s, line=%d]: chrom %s not found [%s]", file, line, s, row);
 	    return FALSE; // chrom not found
 	    }
 	}
     else
 	{
 	verbose(2,"[%s %3d] chrom(%s) \n", __func__, __LINE__, s);
 	return TRUE; // chrom name not blank, and not validating against chromInfo
 	}
     }
 warn("Error [file=%s, line=%d]: chrom column empty [%s]", file, line, row);
 return FALSE;
 }
 
 boolean checkSeq(char *file, int line, char *row, char *s, char *name)
 // Return TRUE if string has non-zero length and contains only chars [ACGTNacgtn0-3]
 // Othewise print warning that name column is empty and return FALSE
 {
 int i;
 for ( i = 0; s[i] ; ++i)
     {
     if (!dnaChars[(int)s[i]])
 	{
 	warn("Error [file=%s, line=%d]: invalid DNA chars in %s(%s) [%s]", file, line, name, s, row);
 	return FALSE;
 	}
     }
 if (i == 0)
     {
     warn("Error [file=%s, line=%d]: %s column empty [%s]", file, line, name, row);
     return FALSE;
     }
 return TRUE;
 }
 
 boolean checkSeqName(char *file, int line, char *s, char firstChar, char *name)
 // Return TRUE if string has non-zero length and contains only seqName[] chars 
 // Othewise print warning that seqName is empty and return FALSE
 {
 int i;
 if (s[0] == 0)
     {
     warn("Error [file=%s, line=%d]: %s empty [%s]", file, line, name, s);
     return FALSE;
     }
 else if (s[0] != firstChar)
     {
     warn("Error [file=%s, line=%d]: %s first char invalid (got '%c', wanted '%c') [%s]", 
 	file, line, name, s[0], firstChar, s);
     return FALSE;
     }
 for ( i = 1; s[i] ; ++i)
     {
     if (!seqName[(int)s[i]])
 	{
 	warn("Error [file=%s, line=%d]: invalid %s chars in [%s]", file, line, name, s);
 	return FALSE;
 	}
     }
 return TRUE;
 }
 
 char *getDigits(char *s)
 // Consume 1 or more digits from s, return pointer to next non-digit
 // Return NULL if no digits consumed
 {
 char *s0 = s;
 while (digits[(int) *s])
     ++s;
 if (s > s0)
     return s;
 else
     return NULL;
 }
 
 boolean checkTrailingCsSeqName(char *s)
 // Return true if all chars in s (if any) are csSeqName chars 
 // Return false otherwise
 {
 while (csSeqName[(int) *s])
     ++s;
 if (*s == 0)
     return TRUE;
 else
     return FALSE;
 }
 
 //     >461_19_209_F3
 //     T022213002230311203200200322000
 //     >920_22_656_F3,1.-152654094.1.35.35.0###,19.43558664.1.35.35.0###
 //     T01301010111200210102321210100112312
 
 boolean checkCsSeqName(char *file, int line, char *s)
 // Return TRUE if string has non-zero length, matches CS name pattern contains only csSeqName[] chars 
 // Othewise print warning that seqName is empty and return FALSE
 {
 char *s0;
 if (s[0] == 0)
     {
     warn("Error [file=%s, line=%d]: sequence name empty [%s]", file, line, s);
     return FALSE;
     }
 else if (s[0] != '>')
     {
     warn("Error [file=%s, line=%d]: sequence name first char invalid (got '%c', wanted '>') [%s]", 
 	file, line, s[0], s);
     return FALSE;
     }
 if ( (s0 = getDigits(s+1)) 
       && (*(s0++) == '_') 
       && (s0 = getDigits(s0)) && (*(s0++) == '_') 
       && (s0 = getDigits(s0)) && (*(s0++) == '_') 
       && alpha[(int) *(s0++)] && digits[(int) *(s0++)] 
       && checkTrailingCsSeqName(s0) )
     {
     verbose(2,"[%s %3d] OK [%s] file(%s) line=%d\n", __func__, __LINE__, s, file, line);
     return TRUE;
     }
 else
     {
     warn("Error [file=%s, line=%d]: invalid sequence name [%s]", file, line, s);
     return FALSE;
     }
 }
 
 boolean checkQual(char *file, int line, char *s)
 // Return TRUE if string has non-zero length and contains only qualChars[] chars 
 // Othewise print warning that quality is empty and return FALSE
 {
 int i;
 for ( i = 0; s[i] ; ++i)
     {
     if (!qualChars[(int)s[i]])
 	{
 	warn("Error [file=%s, line=%d]: invalid quality chars in [%s]", file, line, s);
 	return FALSE;
 	}
     }
 if (i == 0)
     {
     warn("Error [file=%s, line=%d]: quality empty [%s]", file, line, s);
     return FALSE;
     }
 return TRUE;
 }
 
 boolean checkStartEnd(char *file, int line, char *row, char *start, char *end, char *chrom, unsigned chromSize)
 // Return TRUE if start and end are both >= 0,
 // and if zeroSizeOk then start <= end 
 //        otherwise  then start < end
 // Othewise print warning and return FALSE
 {
 unsigned s = sqlUnsigned(start);
 unsigned e = sqlUnsigned(end);
 verbose(2,"[%s %3d] inputLine=%d [%s..%s] -> [%u..%u] (chrom=%s,size=%u) [%s]\n", __func__, __LINE__, line, start, end, s, e, chrom, chromSize, row);
 if (chromSize > 0)
     {
     if (e > chromSize)
 	{
 	warn("Error [file=%s, line=%d]: end(%u) > chromSize(%s=%u) [%s]", file, line, e, chrom, chromSize, row);
 	return FALSE;
 	}
     else
 	verbose(2,"[%s %3d] end <= chromSize (%u <= %u)\n", __func__, __LINE__, e, chromSize);
     }
 if (zeroSizeOk)
     {
     if (s <= e)
 	{
 	verbose(2,"[%s %3d] start <= end (%u <= %u)\n", __func__, __LINE__, s, e);
 	return TRUE;
 	}
     else
 	warn("Error [file=%s, line=%d]: start(%u) > end(%u) [%s]", file, line, s, e, row);
     }
 else
     {
     if (s < e)
 	{
 	verbose(2,"[%s %3d] start < end (%u < %u)\n", __func__, __LINE__, s, e);
 	return TRUE;
 	}
     else
 	warn("Error [file=%s, line=%d]: start(%u) >= end(%u) [%s]", file, line, s, e, row);
     }
 return FALSE;
 }
 
 boolean checkIntBetween(char *file, int line, char *row, char *val, char *name, int min, int max)
 // Return TRUE if val is integer between min and max
 // Othewise print warning and return FALSE
 {
 int i = sqlSigned(val);
 verbose(2,"[%s %3d] inputLine=%d [%s] -> [%d] [%s,%d..%d]\n", __func__, __LINE__, line, val, i, name, min, max);
 if (i >= min && i <= max)
     {
     verbose(2,"[%s %3d] min <= value <= max (%d <= %d <= %d)\n", __func__, __LINE__, min, i, max);
     return TRUE;
     }
 warn("Error [file=%s, line=%d]: %s %d outside bounds (%d, %d) [%s]", file, line, name, i, min, max, row);
 return FALSE;
 }
 
 boolean checkStrand(char *file, int line, char *row, char *strand)
 // Return TRUE if strand == '+' or '-',
 // Othewise print warning and return FALSE
 {
 if (strlen(strand) == 1 && (*strand == '+' || *strand == '-' || *strand == '.'))
     {
     verbose(2,"[%s %3d] strand(%s)\n", __func__, __LINE__, strand);
     return TRUE;
     }
 warn("Error [file=%s, line=%d]: invalid strand '%s' (want '+','-','.') [%s]", file, line, strand, row);
 return FALSE;
 }
 
-int validateTagOrPairedTagAlign(char *file, boolean paired)
+int validateTagOrPairedTagAlign(struct lineFile *lf, char *file, boolean paired)
 {
 char *row;
 char buf[1024];
 char *words[9];
-struct lineFile *lf = lineFileOpen(file, TRUE);
 int line = 0;
 int errs = 0;
 unsigned chromSize;
+int size;
 verbose(2,"[%s %3d] paired=%d file(%s)\n", __func__, __LINE__, paired, file);
-while (lineFileNextReal(lf, &row))
+while (lineFileNext(lf, &row, &size))
     {
     ++line;
     safecpy(buf, sizeof(buf), row);
     int n = chopByWhite(buf, words, 9);
     if ( n != (paired ? 8 : 6))
 	errAbort("Error: found %d columns, expected %d [%s]\n", n, (paired ? 8 : 6), row);
     if (checkChrom(file, line, row, words[0], &chromSize)
 	&& checkStartEnd(file, line, row, words[1], words[2], words[0], chromSize)
 	&& checkIntBetween(file, line, row, words[4], "score", 0, 1000)
 	&& checkStrand(file, line, row, words[5])
 	&& (paired ? 
 		(checkString(file, line, row, words[3], "name")
 		&& checkSeq(file, line, row, words[6], "seq1") 
 		&& checkSeq(file, line, row, words[7], "seq2"))
 	    :
 		checkSeq(file, line, row, words[3], "sequence")
 	    ) )
 	{
 	if (printOkLines)
 	    printf("%s\n", row);
 	}
     else
 	{
 	if (printFailLines)
 	    printf("%s\n", row);
 	if (++errs >= maxErrors)
 	    errAbort("Aborting .. found %d errors\n", errs);
 	}
     }
-lineFileClose(&lf);
 return errs;
 }
 
 // tagAlign
 // chr1     6082    6117    TCTACTGGCTCTGTGTGTACCAGTCTGTCACTGAG     1000    -
 // chr1     7334    7369    AGCCAGGGGGTGACGTTGTTAGATTAGATTTCTTA     1000    +
 
-int validateTagAlign(char *file)
+int validateTagAlign(struct lineFile *lf, char *file)
 {
-return validateTagOrPairedTagAlign(file, FALSE);
+return validateTagOrPairedTagAlign(lf, file, FALSE);
 }
 
 // pairedTagAlign
 // chr10    96316360        96310862        9       1000    +       TCTCACCCGATAACGACCCCCTCCC       TGATCCTTGACTCACTTGCTAATTT
 // chr8    126727657       126721865       10      1000    +       AATTCTTCACCTCTCCTGTTCAAAG       TGTGTGAGATCCAAGAATCCTCTCT
 
-int validatePairedTagAlign(char *file)
+int validatePairedTagAlign(struct lineFile *lf, char *file)
 {
-return validateTagOrPairedTagAlign(file, TRUE);
+return validateTagOrPairedTagAlign(lf, file, TRUE);
 }
 
 // fastq:
 // @NINA_1_FC30G3VAAXX:5:1:110:908
 // ATCGTCAGGTGGGATAATCCTTACCTTTTCCTCCTC
 // +NINA_1_FC30G3VAAXX:5:1:110:908
 // aa`]`a`XQ^VQQ^`aaaaaaa^[[ZG[aXUX[[[X
 
-int validateFastq(char *file)
+int validateFastq(struct lineFile *lf, char *file)
 {
-char *seqName = NULL;
-char *seq = NULL; 
-char *qName = NULL;
-char *qual = NULL;
+char *seqName, *seq, *qName, *qual;
 int line = 0;
 int errs = 0;
 boolean startOfFile = TRUE;
-FILE *f = mustOpen(file, "rb");
 verbose(2,"[%s %3d] file(%s)\n", __func__, __LINE__, file);
-while ( (seqName = readLine(f)) )
+while ( lineFileNext(lf, &seqName, NULL))
     {
     ++line;
     if (startOfFile)
 	{
 	if (*seqName == '#')
-	    {
-	    freez(&seqName);
 	    continue;
-	    }
 	else
 	    startOfFile = FALSE;
 	}
     if (checkSeqName(file, line, seqName, '@', "sequence name")
-	&& (seq = readLine(f))
+	&& (lineFileNext(lf, &seq, NULL))
 	&& checkSeq(file, ++line, seq, seq, "sequence")
-	&& (qName = readLine(f))
+	&& (lineFileNext(lf, &qName, NULL))
 	&& checkSeqName(file, ++line, qName, '+', "quality name")
-	&& (qual = readLine(f))
+	&& (lineFileNext(lf, &qual, NULL))
 	&& checkQual(file, ++line, qual) )
 	{
 	if (printOkLines)
 	    printf("%s\n%s\n%s\n%s\n", seqName, seq, qName, qual);
 	}
     else
 	{
 	if (printFailLines)
 	    printf("%s\n%s\n%s\n%s\n", seqName, seq, qName, qual);
 	if (++errs >= maxErrors)
 	    errAbort("Aborting .. found %d errors\n", errs);
 	}
-    freez(&seqName);
-    freez(&seq);
-    freez(&qName);
-    freez(&qual);
     }
-carefulClose(&f);
 return errs;
 }
 
 // CS Fasta:
 // >461_19_209_F3
 // T022213002230311203200200322000
 // >920_22_656_F3,1.-152654094.1.35.35.0###,19.43558664.1.35.35.0###
 // T01301010111200210102321210100112312
 
-int validateCsfasta(char *file)
+int validateCsfasta(struct lineFile *lf, char *file)
 {
 char *seqName = NULL;
 char *seq = NULL; 
 int line = 0;
 int errs = 0;
 boolean startOfFile = TRUE;
-FILE *f = mustOpen(file, "rb");
 verbose(2,"[%s %3d] file(%s)\n", __func__, __LINE__, file);
-while ( (seqName = readLine(f)) )
+while (lineFileNext(lf, &seqName, NULL))
     {
     ++line;
     if (startOfFile)
 	{
 	if (*seqName == '#')
-	    {
-	    freez(&seqName);
 	    continue;
-	    }
 	else
 	    startOfFile = FALSE;
 	}
     if (checkCsSeqName(file, line, seqName)
-	&& (seq = readLine(f))
+	&& (lineFileNext(lf, &seq, NULL))
 	&& checkSeq(file, ++line, seq, seq, "sequence") )
 	{
 	if (printOkLines)
 	    printf("%s\n%s\n", seqName, seq);
 	}
     else
 	{
 	if (printFailLines)
 	    printf("%s\n%s\n", seqName, seq);
 	if (++errs >= maxErrors)
 	    errAbort("Aborting .. found %d errors\n", errs);
 	}
-    freez(&seqName);
-    freez(&seq);
     }
-carefulClose(&f);
 return errs;
 }
 
-void validateFiles(int (*validate)(char *file), int numFiles, char *files[])
+void validateFiles(int (*validate)(struct lineFile *lf, char *file), int numFiles, char *files[])
 /* validateFile - validate format of different track input files. */
 {
 int i;
 int errs = 0;
 verbose(2,"[%s %3d] numFiles=%d \n", __func__, __LINE__, numFiles);
 for (i = 0; i < numFiles ; ++i)
     {
-    errs += validate(files[i]);
+    struct lineFile *lf = lineFileOpen(files[i], TRUE);
+    errs += validate(lf, files[i]);
+    lineFileClose(&lf);
     }
 verbose(2,"[%s %3d] done loop\n", __func__, __LINE__);
 if (errs > 0) 
     errAbort("Aborting ... found %d errors in total\n", errs);
 verbose(2,"[%s %3d] done\n", __func__, __LINE__);
 }
 
+int testFunc(char *f)
+{
+char *row;
+int size;
+struct lineFile *lf = lineFileOpen(f, TRUE);
+while (lineFileNext(lf, &row, &size))
+    printf("size=%d [%s]\n", size, row);
+printf("done.\n");
+return 0;
+}
+
 int main(int argc, char *argv[])
 /* Process command line. */
 {
 char *type;
 void *func;
 struct chromInfo *ci = NULL;
 struct hash *funcs = newHash(0);
 optionInit(&argc, argv, options);
 ++argv; 
 --argc;
 initArrays();
 if (optionExists("version"))
     errAbort(version);
 if (argc==0)
     usage();
 type = optionVal("type", "");
 if (strlen(type) == 0)
     errAbort("please specify type");
 maxErrors      = optionInt("maxErrors", MAX_ERRORS);
 zeroSizeOk     = optionExists("zeroSizeOk");
 printOkLines   = optionExists("printOkLines");
 printFailLines = optionExists("printFailLines");
 if (strlen(optionVal("chromInfo", "")) > 0)
     {
     if (!(ci = chromInfoLoadAll(optionVal("chromInfo", ""))))
 	errAbort("could not load chromInfo file %s\n", optionVal("chromInfo", ""));
     chrHash = chromHash(ci);
     chromInfoFree(&ci);
     }
 verbose(2,"[%s %3d] type=%s\n", __func__, __LINE__, type);
 // Setup the function hash keyed by type
 hashAdd(funcs, "tagAlign", &validateTagAlign);
 hashAdd(funcs, "pairedTagAlign", &validatePairedTagAlign);
 hashAdd(funcs, "fastq", &validateFastq);
 hashAdd(funcs, "csfasta", &validateCsfasta);
+//hashAdd(funcs, "test", &testFunc);
 if (!(func = hashFindVal(funcs, type)))
     errAbort("Cannot validate %s type files\n", type);
 validateFiles(func, argc, argv);
 return 0;
 }