src/hg/makeDb/doc/hg19.txt 1.11

1.11 2009/05/11 20:50:57 hiram
Running Mouse Mm9 and Dog CanFam2 blastz
Index: src/hg/makeDb/doc/hg19.txt
===================================================================
RCS file: /projects/compbio/cvsroot/kent/src/hg/makeDb/doc/hg19.txt,v
retrieving revision 1.10
retrieving revision 1.11
diff -b -B -U 1000000 -r1.10 -r1.11
--- src/hg/makeDb/doc/hg19.txt	8 May 2009 22:23:22 -0000	1.10
+++ src/hg/makeDb/doc/hg19.txt	11 May 2009 20:50:57 -0000	1.11
@@ -1,2101 +1,2175 @@
 # for emacs: -*- mode: sh; -*-
 
 # This file describes how we made the browser database on
 # NCBI build 37 (February 2009 freeze) aka:
 #	GRCh37 - Genome Reference Consortium Human Reference 37
 #	Assembly Accession: GCA_000001405.1
 
 #	"$Id$";
 
 #############################################################################
 # Download sequence (DONE - 2009-02-04 - Hiram)
     mkdir -p /hive/data/genomes/hg19/download
     cd /hive/data/genomes/hg19/download
     mkdir -p assembled_chromosomes
     wget --cut-dirs=8 --no-parent --timestamping --no-remove-listing -m \
         --directory-prefix=assembled_chromosomes \
         -nH --ftp-user=anonymous --ftp-password=yourEmail@your.domain \
 ftp://ftp.ncbi.nlm.nih.gov/genbank/genomes/Eukaryotes/vertebrates_mammals/Homo_sapiens/GRCh37/Primary_Assembly/assembled_chromosomes
 
     mkdir -p alternate_loci
 for N in 1 2 3 4 5 6 7 8 9
 do
 wget --cut-dirs=6 --no-parent --timestamping --no-remove-listing -m \
     --directory-prefix=alternate_loci \
         -nH --ftp-user=anonymous --ftp-password=yourEmail@your.domain \
 ftp://ftp.ncbi.nlm.nih.gov/genbank/genomes/Eukaryotes/vertebrates_mammals/Homo_sapiens/GRCh37/ALT_REF_LOCI_${N}
 done
 
     mkdir -p unlocalized_scaffolds
     wget --cut-dirs=8 --no-parent --timestamping --no-remove-listing -m \
         --directory-prefix=unlocalized_scaffolds \
 	    -nH --ftp-user=anonymous --ftp-password=yourEmail@your.domain \
 ftp://ftp.ncbi.nlm.nih.gov/genbank/genomes/Eukaryotes/vertebrates_mammals/Homo_sapiens/GRCh37/Primary_Assembly/unlocalized_scaffolds
 
     mkdir -p unplaced_scaffolds
     wget --cut-dirs=8 --no-parent --timestamping --no-remove-listing -m \
         --directory-prefix=unplaced_scaffolds \
 	    -nH --ftp-user=anonymous --ftp-password=yourEmail@your.domain \
 ftp://ftp.ncbi.nlm.nih.gov/genbank/genomes/Eukaryotes/vertebrates_mammals/Homo_sapiens/GRCh37/Primary_Assembly/unplaced_scaffolds
 
     mkdir -p placed_scaffolds
     wget --cut-dirs=8 --no-parent --timestamping --no-remove-listing -m \
         --directory-prefix=placed_scaffolds \
 	    -nH --ftp-user=anonymous --ftp-password=hiram@soe.ucsc.edu \
 ftp://ftp.ncbi.nlm.nih.gov/genbank/genomes/Eukaryotes/vertebrates_mammals/Homo_sapiens/GRCh37/Primary_Assembly/placed_scaffolds
 
     mkdir ucscChr
     cd ucscChr
     for F in ../assembled_chromosomes/FASTA/chr*.fa
 do
     C=`basename $F`
     C=${C/.fa}
     echo -n "${C} "
     H=`head -1 "${F}"`
     chrN=`echo $H | sed -e "s/.*Homo sapiens chromosome /chr/; s/, .*//"`
     A=`echo $H | sed -e "s/. Homo.*//; s/.*gb.//"`
     echo $chrN $A
     grep -v "^#" ../assembled_chromosomes/AGP/${chrN}.comp.agp \
         | sed -e "s/^${A}/${chrN}/" > ${chrN}.agp
     echo ">${chrN}" > ${chrN}.fa
     grep -v "^>" ../assembled_chromosomes/FASTA/${chrN}.fa >> ${chrN}.fa
 done
 
     rm -f scaffolds.agp
     find ../alternate_loci -type f | grep ".agp$" | while read F
 do
     grep "^GL" $F | sed -e \
 "s/^GL000250.1/chr6_apd_hap1/" -e \
 "s/^GL000251.1/chr6_cox_hap2/" -e \
 "s/^GL000252.1/chr6_dbb_hap3/" -e \
 "s/^GL000253.1/chr6_mann_hap4/" -e \ 
 "s/^GL000254.1/chr6_mcf_hap5/" -e \
 "s/^GL000255.1/chr6_qbl_hap6/" -e \
 "s/^GL000256.1/chr6_ssto_hap7/" -e \
 "s/^GL000257.1/chr4_ctg9_hap1/" -e \
 "s/^GL000258.1/chr17_ctg5_hap1/"
 done > scaffolds.agp
 
     find ../unlocalized_scaffolds -type f | grep ".agp$" \
 | while read F
 do
     C=`basename ${F}`   
     C=${C/.unlocalized.scaf.agp}
     grep "^GL" ${F} | sed -e "s/^GL\([0-9]*\).1/${C}_gl\1_random/"
 done >> scaffolds.agp
 
     find ../unplaced_scaffolds -type f | grep ".agp$" \
 | while read F
 do
     grep "^GL" ${F} | sed -e "s/^GL\([0-9]*\).1/chrUn_gl\1/"
 done >> scaffolds.agp
 
     rm -f scaffolds.fa
     find ../alternate_loci -type f | grep ".fa$" | while read F
 do  
     sed -e \
 "s/>.*GL000250.*/>chr6_apd_hap1/" -e \
 "s/>.*GL000251.*/>chr6_cox_hap2/" -e \
 "s/>.*GL000252.*/>chr6_dbb_hap3/" -e \
 "s/>.*GL000253.*/>chr6_mann_hap4/" -e \
 "s/>.*GL000254.*/>chr6_mcf_hap5/" -e \
 "s/>.*GL000255.*/>chr6_qbl_hap6/" -e \
 "s/>.*GL000256.*/>chr6_ssto_hap6/" -e \
 "s/>.*GL000257.*/>chr4_ctg9_hap1/" -e \
 "s/>.*GL000258.*/>chr17_ctg5_hap1/" ${F}
 done > scaffolds.fa
 
     find ../unlocalized_scaffolds -type f | grep ".fa$" | while read F
 do
     sed -e \
 "s/^>.*GL\([0-9]*\).* chromosome \([0-9]*\).*/>chr\2_gl\1_random/" ${F}
 done >> scaffolds.fa
 
     find ../unplaced_scaffolds -type f | grep ".fa$" | while read F
 do
     sed -e "s/.*\(GL[0-9]*\).*/\1/; s/GL/>chrUn_gl/" $F
 done >> scaffolds.fa
 
 
 ############################################################################
 ## Create database (DONE - 2009-03-04 - Hiram)
     cd /hive/data/genomes/hg19
     cat << '_EOF_' > hg19.config.ra
 # Config parameters for makeGenomeDb.pl:
 db hg19
 scientificName Homo sapiens
 commonName Human
 assemblyDate Feb. 2009
 assemblyLabel GRCh37 Genome Reference Consortium Human Reference 37 (GCA_000001405.1)
 orderKey 14
 mitoAcc NC_001807
 fastaFiles /hive/data/genomes/hg19/download/ucscChr/*.fa
 agpFiles /hive/data/genomes/hg19/download/ucscChr/*.agp
 # qualFiles /dev/null
 dbDbSpeciesDir human
 taxId	9606
 '_EOF_'
     # << happy emacs
 
     time makeGenomeDb.pl hg19.config.ra > makeGenomeDb.log 2>&1
     #	real    14m8.958s
      featureBits -countGaps hg19 gap
     #	239845127 bases of 3137161264 (7.645%) in intersection
     featureBits -noRandom -noHap -countGaps hg19 gap
     #	234344806 bases of 3095693983 (7.570%) in intersection
     #	verify featureBits is properly ignorning haps and randoms:
     egrep -v "_" chrom.sizes | awk '{sum+=$2;print sum,$0}'
     #	3095693983 chrM 16571
     #	same total as in featureBits
 
     #	much later on, discovered that we needed a chrM definition in the
     #	agp files, added by hand to hg19/M/chrM.agp and hg19/hg19.agp the line:
 # chrM    1       16571   1       F       NC001807        1       16571   +
     #	the spaces there are tabs
 
 ############################################################################
 # running repeat masker (DONE - 2009-03-05 - Hiram)
     screen # use screen to manage this day-long job
     mkdir /hive/data/genomes/hg19/bed/repeatMasker
     cd /hive/data/genomes/hg19/bed/repeatMasker
     time doRepeatMasker.pl -bigClusterHub=swarm -buildDir=`pwd` hg19 \
 	> do.log 2>&1
     #	real    525m23.521s
     cat faSize.rmsk.txt
     #	3137161264 bases (239850802 N's 2897310462 real 1431585691
     #	upper 1465724771 lower) in 93 sequences in 1 files
     #	%46.72 masked total, %50.59 masked real
     featureBits -countGaps hg19 rmsk
     #	1465724774 bases of 3137161264 (46.721%) in intersection
     #	this is odd, 3 bases more in featureBits than were masked ?
     #	check it out, make a bed file from the featureBits:
     featureBits -countGaps -bed=rmsk.bed hg19 rmsk
     #	went down a sequence of intersections with this idea, but could
     #	not get it resolved.  It appears there are 75 bases in the rmsk
     #	table that were not masked in the 2bit file ?
     #	Later on, realized that featureBits does not count lower case N's
     #	in the "lower" category, but only in the N's category.
 
     #	trying a non-split table:
     hgsql -e "show tables;" hg19 | grep _rmsk | while read T
 do
     hgsql -e "drop table ${T};" hg19
 done
     hgLoadOut -nosplit -verbose=2 -table=rmsk hg19 hg19.fa.out
 bad rep range [4385, 4384] line 1348605 of hg19.fa.out 
 bad rep range [5563, 5562] line 1563988 of hg19.fa.out 
 bad rep range [4539, 4538] line 3111186 of hg19.fa.out 
     #	featureBits still reports 1465724774 bases in rmsk table
     #	cleaning the hg19.fa.out file:
     cp hg19.fa.out hg19.clean.out
     # edit hg19.clean.out and remove the three lines:
 # 1467  20.7  1.2 17.6  chr14     35056767 35056794 (72292746) +  L1ME1          LINE/L1               4385 4384 (1761) 1120962
 # 1943  23.8  5.0 12.6  chr15     65775909 65775924 (36755468) +  L1MC4          LINE/L1               5563 5562 (2480) 1299299
 # 2463  25.1  5.0 11.6  chr3      121291056 121291083 (76731347) +  L1M3           LINE/L1               4539 4538 (1608) 2589267
 
     #	reload the table
     hgsql -e "drop table rmsk;" hg19
     hgLoadOut -nosplit -verbose=2 -table=rmsk hg19 hg19.clean.out
 
     #	try masking with this clean file:
     twoBitMask /hive/data/genomes/hg19/hg19.unmasked.2bit hg19.clean.out \
 	hg19.clean.2bit
     twoBitToFa hg19.clean.2bit stdout | faSize stdin > faSize.clean.txt
     cat faSize.clean.txt
     #	this gives the lower by 75 bases result:
     #	3137161264 bases (239850802 N's 2897310462 real 1431585763 upper
     #	1465724699 lower) in 93 sequences in 1 files
     #	%46.72 masked total, %50.59 masked real
     featureBits -countGaps hg19 rmsk
     #	1465724774 bases of 3137161264 (46.721%) in intersection
     #	is the countGaps interferring ?
     featureBits hg19 rmsk
     #	1465724774 bases of 2897316137 (50.589%) in intersection
     #	nope, lets' see what the .out file has:
     grep chr hg19.clean.out | sed -e "s/^  *//" | awk '{print $5,$6-1,$7}' \
 	| sort -k1,1 -k2,2n > hg19.clean.out.bed
     featureBits -countGaps hg19 hg19.clean.out.bed
     #	1465724774 bases of 3137161264 (46.721%) in intersection
     #	is it perhaps not masking N's ?
     twoBitToFa hg19.clean.2bit stdout | grep n | less
     #	that does find some lower case n's, find all N's:
     findMotif -strand=+ -motif=gattaca -verbose=4 hg19.clean.2bit \
 	2> findMotif.out
     grep "^#GAP" findMotif.out | sed -e "s/#GAP //" > nLocations.bed
     #	which cover:
     featureBits -countGaps hg19 nLocations.bed
     #	251299071 bases of 3137161264 (8.010%) in intersection
     #	overlapping rmsk business with these N locations:
     featureBits -countGaps hg19 hg19.clean.out.bed nLocations.bed
     #	6494740 bases of 3137161264 (0.207%) in intersection
     #	and overlapping with gap:
     featureBits -countGaps hg19 gap nLocations.bed
     #	239845127 bases of 3137161264 (7.645%) in intersection
 
 ############################################################################
 # running TRF simple repeats (DONE - 2009-03-05 - Hiram)
     screen # use screen to manage this day-long job
     mkdir /hive/data/genomes/hg19/bed/simpleRepeat
     cd /hive/data/genomes/hg19/bed/simpleRepeat
     time doSimpleRepeat.pl -bigClusterHub=pk -workhorse=hgwdev \
 	-smallClusterHub=pk -buildDir=`pwd` hg19 > do.log 2>&1
     #	real    33m25.815s
 
     twoBitMask bed/repeatMasker/hg19.clean.2bit \
 	-add bed/simpleRepeat/trfMask.bed hg19.2bit
     twoBitToFa hg19.2bit stdout | faSize stdin > faSize.hg19.2bit.txt
 # 3137161264 bases (239850802 N's 2897310462 real 1430387259 upper
 # 1466923203 lower) in 93 sequences in 1 files
 # %46.76 masked total, %50.63 masked real
 
 ############################################################################
 #	prepare cluster data (DONE - 2009-03-06 - Hiram)
     cd /hive/data/genomes/hg19
     rm /gbdb/hg19/hg19.2bit
     ln -s `pwd`/hg19.2bit /gbdb/hg19/hg19.2bit
 
     time blat hg19.2bit \
 	/dev/null /dev/null -tileSize=11 -makeOoc=11.ooc -repMatch=1024
     #	Wrote 30675 overused 11-mers to 11.ooc
     #	real    3m11.302s
 
     mkdir /hive/data/staging/data/hg19
     cp -p hg19.2bit /hive/data/staging/data/hg19
     cp -p 11.ooc /hive/data/staging/data/hg19
     cp -p chrom.sizes /hive/data/staging/data/hg19
 
     mkdir separateChrs
     cd separateChrs
     grep -v "_" ../chrom.sizes | awk '{print $1}' | while read C
 do
     twoBitToFa -seq="${C}" ../hg19.2bit stdout
 done | faToTwoBit stdin hg19.chrOnly.2bit
     twoBitInfo hg19.chrOnly.2bit stdout | sort -k2,2nr > chrOnly.chrom.sizes
 
     grep "_hap" ../chrom.sizes | awk '{print $1}' | while read C
 do
     twoBitToFa -seq="${C}" ../hg19.2bit stdout
 done | faToTwoBit stdin hg19.hapOnly.2bit
     twoBitInfo hg19.hapOnly.2bit stdout | sort -k2,2nr > hapOnly.chrom.sizes
 
     grep "_" ../chrom.sizes | grep -v "_hap" | awk '{print $1}' | while read C
 do
     twoBitToFa -seq="${C}" ../hg19.2bit stdout
 done | faToTwoBit stdin hg19.scaffolds.2bit
     twoBitInfo hg19.scaffolds.2bit stdout | sort -k2,2nr > scaffolds.chrom.sizes
 
     cp -p *.2bit *.sizes /hive/data/staging/data/hg19
 
     # ask admin to sync this directory: /hive/data/staging/data/hg19/
     #	to the kluster nodes /scratch/data/hg19/
 
 ############################################################################
 # running cpgIsland business (DONE - 2009-03-06 - Hiram)
     mkdir /hive/data/genomes/hg19/bed/cpgIsland
     cd /hive/data/genomes/hg19/bed/cpgIsland
     cvs -d /projects/compbio/cvsroot checkout -P hg3rdParty/cpgIslands
     cd hg3rdParty/cpgIslands
     # comment out the following two lines if it compiles cleanly
     # some day  (there were some other fixups too, adding include lines)
     sed -e "s#\(extern char\* malloc\)#// \1#" cpg_lh.c > tmp.c
     mv tmp.c cpg_lh.c
     make
     cd ../../ 
     ln -s hg3rdParty/cpgIslands/cpglh.exe
     mkdir -p hardMaskedFa
     cut -f1 ../../chrom.sizes | while read C
 do
     echo ${C}
     twoBitToFa ../../hg19.2bit:$C stdout \
 	| maskOutFa stdin hard hardMaskedFa/${C}.fa
 done
 
     cut -f1 ../../chrom.sizes > chr.list
     cat << '_EOF_' > template
 #LOOP
 ./runOne $(root1) {check out line results/$(root1).cpg}
 #ENDLOOP
 '_EOF_'
     # << happy emacs
 
     cat << '_EOF_' > runOne
 #!/bin/csh -fe
 ./cpglh.exe hardMaskedFa/$1.fa > /scratch/tmp/$1.$$
 mv /scratch/tmp/$1.$$ $2
 '_EOF_'
     # << happy emacs
 
     gensub2 chr.list single template jobList
     para create jobList
     para try
     para check ... etc
     para time
 # Completed: 93 of 93 jobs
 # CPU time in finished jobs:        172s       2.86m     0.05h    0.00d  0.000 y
 # IO & Wait Time:                  1748s      29.14m     0.49h    0.02d  0.000 y
 # Average job time:                  21s       0.34m     0.01h    0.00d
 # Longest finished job:              34s       0.57m     0.01h    0.00d
 # Submission to last job:            83s       1.38m     0.02h    0.00d
 
     # Transform cpglh output to bed +
     catDir results | awk '{
 $2 = $2 - 1;
 width = $3 - $2;
 printf("%s\t%d\t%s\t%s %s\t%s\t%s\t%0.0f\t%0.1f\t%s\t%s\n",
        $1, $2, $3, $5,$6, width,
        $6, width*$7*0.01, 100.0*2*$6/width, $7, $9);
 }' > cpgIsland.bed
 
     cd /hive/data/genomes/hg19/bed/cpgIsland
     hgLoadBed hg19 cpgIslandExt -tab \
       -sqlTable=$HOME/kent/src/hg/lib/cpgIslandExt.sql cpgIsland.bed
 
 # Reading cpgIsland.bed
 # Loaded 28226 elements of size 10
 # Sorted
 # Saving bed.tab
 # Loading hg19
 
 ############################################################################
 # create lift file on unBridged gaps for genbank splits (2009-03-09 - Hiram)
     mkdir /hive/data/genomes/hg19/bed/gap
     cd /hive/data/genomes/hg19/bed/gap
     gapToLift hg19 hg19.unBridged.lift -bedFile=unBridged.lift.bed
     cp -p hg19.unBridged.lift ../../jkStuff
     cp -p hg19.unBridged.lift /hive/data/staging/data/hg19
 
 ############################################################################
 # AUTO UPDATE GENBANK RUN  (DONE - 2009-03-07,13 - Hiram)
     # align with latest genbank process.
     cd ~/kent/src/hg/makeDb/genbank
     cvsup
     # edit etc/genbank.conf to add hg19 just after hg18
 
 # hg19 - GRCh37 - Genome Reference Consortium Human Reference 37
 #       Assembly Accession: GCA_000001405.1
 hg19.serverGenome = /hive/data/genomes/hg19/hg19.2bit
 hg19.clusterGenome = /scratch/data/hg19/hg19.2bit
 hg19.ooc = /scratch/data/hg19/11.ooc
 hg19.lift = /scratch/data/hg19/hg19.unBridged.lift
 # hg19.hapRegions = /hive/data/genomes/hg19/bed/haplotypePos/haplotypePos.psl
 hg19.refseq.mrna.native.pslCDnaFilter  = ${finished.refseq.mrna.native.pslCDnaFilter}
 hg19.refseq.mrna.xeno.pslCDnaFilter    = ${finished.refseq.mrna.xeno.pslCDnaFilter}
 hg19.genbank.mrna.native.pslCDnaFilter = ${finished.genbank.mrna.native.pslCDnaFilter}
 hg19.genbank.mrna.xeno.pslCDnaFilter   = ${finished.genbank.mrna.xeno.pslCDnaFilter}
 hg19.genbank.est.native.pslCDnaFilter = ${finished.genbank.est.native.pslCDnaFilter}
 hg19.genbank.est.xeno.pslCDnaFilter   = ${finished.genbank.est.xeno.pslCDnaFilter}
 hg19.genbank.est.xeno.load = yes
 hg19.refseq.mrna.xeno.load  = yes
 hg19.refseq.mrna.xeno.loadDesc = yes
 hg19.mgc = yes
 hg19.orfeome = yes
 hg19.downloadDir = hg19
 # hg19.ccds.ncbiBuild = 36.3
 # hg19.upstreamGeneTbl = refGene
 # hg19.upstreamMaf = multiz28way
 # /hive/data/genomes/hg19/bed/multiz28way/species.lst multiz44way
 # /hive/data/genomes/hg19/bed/multiz44way/species.list
 hg19.genbank.mrna.blatTargetDb = yes
 
     cvs ci -m "Added hg19." etc/genbank.conf
     # update /cluster/data/genbank/:
     make etc-update
 
     ssh genbank
     screen		#	use a screen to manage this job
     cd /cluster/data/genbank
     time nice -n +19 bin/gbAlignStep -initial hg19 &
     #	logFile: var/build/logs/2009.03.10-20:28:44.hg19.initalign.log
     #	real    2761m13.680s
     #	that ran on the swarm with little interference and no problems
 
     # load database when finished
     ssh hgwdev
     screen	# use screen to manage this long running command
     cd /cluster/data/genbank
     time nice -n +19 ./bin/gbDbLoadStep -drop -initialLoad hg19 &
     # logFile: var/dbload/hgwdev/logs/2009.03.12-21:10:02.dbload.log
     #	real    369m11.941s
 
     # enable daily alignment and update of hgwdev (DONE - 2009-02-24 - Hiram)
     cd ~/kent/src/hg/makeDb/genbank
     cvsup
     # add hg19 to:
         etc/align.dbs
         etc/hgwdev.dbs
     cvs ci -m "Added hg19 - Human - GRCh37" etc/align.dbs etc/hgwdev.dbs
     make etc-update
 
 #########################################################################
 #  BLATSERVERS ENTRY (DONE - 2009-03-09 - Hiram)
 #	After getting a blat server assigned by the Blat Server Gods,
     ssh hgwdev
 
     hgsql -e 'INSERT INTO blatServers (db, host, port, isTrans, canPcr) \
 	VALUES ("hg19", "blat13", "17778", "1", "0"); \
 	INSERT INTO blatServers (db, host, port, isTrans, canPcr) \
 	VALUES ("hg19", "blat13", "17779", "0", "1");' \
 	    hgcentraltest
     #	test it with some sequence
 
 ############################################################################
 # Making download files (DONE - 2009-03-13 - Hiram)
     cd /hive/data/genomes/hg19
     makeDownloads.pl -allowMissedTrfs -noChromRoot hg19 \
 	> downloads.log 2>&1
 ############################################################################
 # Venter1 chain, net experiment (DONE - Hiram - 2009-03-15)
 doBlastzChainNet.pl `pwd`/DEF \
         -stop=partition -bigClusterHub=swarm \
         -smallClusterHub=swarm -chainMinScore=1000 -chainLinearGap=medium \
         -workhorse=hgwdev -fileServer=hgwdev > partition.log 2>&1
 
 doBlastzChainNet.pl `pwd`/DEF \
         -continue=blastz -stop=blastz -bigClusterHub=swarm \
         -smallClusterHub=swarm -chainMinScore=1000 -chainLinearGap=medium \
         -workhorse=hgwdev -fileServer=hgwdev > blastz.log 2>&1
 
 doBlastzChainNet.pl `pwd`/DEF \
         -continue=cat -stop=net -bigClusterHub=swarm \
         -smallClusterHub=swarm -chainMinScore=1000 -chainLinearGap=medium \
         -workhorse=hgwdev -fileServer=hgwdev > net.log 2>&1
 real    163m28.438s
 
     # to load, run it in debug, then check the load script
 doBlastzChainNet.pl `pwd`/DEF \
 	-noLoadChainSplit -continue=load -stop=load -bigClusterHub=swarm \
 	-debug -smallClusterHub=swarm -chainMinScore=1000 \
 	-chainLinearGap=medium \
 	-workhorse=hgwdev -fileServer=hgwdev > load.log 2>&1
 
     # and create a synNet for multiz, run in debug, and examine script
     #	to make sure it works correctly
 doBlastzChainNet.pl `pwd`/DEF \
 	-syntenicNet -continue=syntenicNet -stop=syntenicNet \
 	-debug -bigClusterHub=swarm \
 	-smallClusterHub=swarm -chainMinScore=1000 -chainLinearGap=medium \
 	-workhorse=hgwdev -fileServer=hgwdev > synNet.log 2>&1
     #	real    31m11.216s
 
 ############################################################################
 # reset position to chr6 haplotype situation
     hgsql -e \
 'update dbDb set defaultPos="chr6:28343766-33555363" where name="hg19";' \
 	hgcentraltest
 
 # reset to a smaller range (2009-04-24 - Brooke)
 # this is the SOD1 gene, implicated in Lou Gehrig's disease.
 
     hgsql -e \
 'update dbDb set defaultPos="chr21:33,031,597-33,041,570" where name="hg19";' \
         hgcentraltest
 
 ############################################################################
 # Self Lastz run (DONE - 2009-03-19 - Hiram)
     mkdir /hive/data/genomes/hg19/bed/lastzSelf.2009-03-19
     cd /hive/data/genomes/hg19/bed/lastzSelf.2009-03-19
     cat << '_EOF_'
 # human vs human
 BLASTZ=lastz
 # maximum M allowed with lastz is only 255
 BLASTZ_M=254
 # lastz does not like the O= and E= lines in the matrix file 
 #       this copy has that removed from /scratch/data/scratch/human_chimp.v2.q
 BLASTZ_Q=/hive/data/genomes/hg19/bed/lastzHg19Haps.2009-03-09/human_chimp.v2.q
 # and place those items here
 BLASTZ_O=600
 BLASTZ_E=150
 # other parameters from hg18 vs venter1 lastz on advice from Webb
 BLASTZ_K=10000
 BLASTZ_Y=15000
 BLASTZ_T=2
 
 # TARGET: Human Hg19
 SEQ1_DIR=/scratch/data/hg19/hg19.2bit
 SEQ1_LEN=/scratch/data/hg19/chrom.sizes
 SEQ1_CHUNK=10000000
 SEQ1_LAP=10000
 SEQ1_IN_CONTIGS=0
     
 # QUERY: Human Hg19
 SEQ2_DIR=/scratch/data/hg19/hg19.2bit
 SEQ2_LEN=/scratch/data/hg19/chrom.sizes
 SEQ2_CHUNK=10000000
 SEQ2_LAP=0
 SEQ2_IN_CONTIGS=0
     
 BASE=/hive/data/genomes/hg19/bed/lastzSelf.2009-03-19
 TMPDIR=/scratch/tmp
 '_EOF_'
     # << happy emacs
 
     screen # use screen to manage this long-running job
     time nice -n +19 doBlastzChainNet.pl `pwd`/DEF -verbose=2 \
 	-noLoadChainSplit -chainMinScore=2000 -chainLinearGap=medium \
 	-workhorse=hgwdev \
 	-stop=net -smallClusterHub=pk -bigClusterHub=swarm > do.log 2>&1 &
     #	cluster difficulties, finished manually, then:
     time nice -n +19 doBlastzChainNet.pl `pwd`/DEF -verbose=2 \
 	-noLoadChainSplit -chainMinScore=2000 -chainLinearGap=medium \
 	-continue=cat -workhorse=hgwdev \
 	-stop=net -smallClusterHub=pk -bigClusterHub=swarm > cat.log 2>&1 &
 
     time nice -n +19 doBlastzChainNet.pl `pwd`/DEF -verbose=2 \
 	-noLoadChainSplit -chainMinScore=2000 -chainLinearGap=medium \
 	-continue=load -debug -workhorse=hgwdev \
 	-stop=load -smallClusterHub=pk -bigClusterHub=swarm > load.debug.log 2>&1 &
     #	that indicates it would do:
     hgLoadChain -tIndex hg19 chainSelf hg19.hg19.all.chain.gz
     #	adding -normScore
     hgLoadChain -normScore -tIndex hg19 chainSelf hg19.hg19.all.chain.gz
 
 ############################################################################
 # Chimp Lastz run (WORKING - 2009-03-19 - Hiram)
     mkdir /hive/data/genomes/hg19/bed/lastzPanTro2.2009-03-19
     cd /hive/data/genomes/hg19/bed/lastzPanTro2.2009-03-19
     cat << '_EOF_'
 # human vs chimp
 BLASTZ=lastz
 # maximum M allowed with lastz is only 254
 BLASTZ_M=254
 # lastz does not like the O= and E= lines in the matrix file
 #       this copy has that removed from /scratch/data/scratch/human_chimp.v2.q
 BLASTZ_Q=/hive/data/genomes/hg19/bed/lastzHg19Haps.2009-03-09/human_chimp.v2.q
 # and place those items here
 BLASTZ_O=600
 BLASTZ_E=150
 # other parameters from panTro2 vs hg18 lastz on advice from Webb
 BLASTZ_K=4500
 BLASTZ_Y=15000
 BLASTZ_T=2
 
 # TARGET: Human Hg19
 SEQ1_DIR=/scratch/data/hg19/hg19.2bit
 SEQ1_LEN=/scratch/data/hg19/chrom.sizes
 SEQ1_CHUNK=10000000
 SEQ1_LAP=10000
 SEQ1_IN_CONTIGS=0
 
 # QUERY: Chimp PanTro2
 SEQ2_DIR=/scratch/data/panTro2/panTro2.2bit
 SEQ2_LEN=/scratch/data/panTro2/chrom.sizes
 SEQ2_CHUNK=10000000
 SEQ2_LAP=0
 SEQ2_IN_CONTIGS=0
 
 BASE=/hive/data/genomes/hg19/bed/lastzPanTro2.2009-03-19
 TMPDIR=/scratch/tmp
 '_EOF_'
     # << happy emacs
 
     screen # use screen to manage this long-running job
     time nice -n +19 doBlastzChainNet.pl `pwd`/DEF -verbose=2 \
 	-noLoadChainSplit -chainMinScore=5000 -chainLinearGap=medium \
 	-workhorse=hgwdev -smallClusterHub=pk -bigClusterHub=swarm > do.log 2>&1 &
     #	real    173m22.880s
     #	cluster problems, continuing after lastz done:
     time nice -n +19 doBlastzChainNet.pl `pwd`/DEF -verbose=2 -continue=cat \
 	-stop=net -noLoadChainSplit -chainMinScore=5000 -chainLinearGap=medium \
 	-workhorse=hgwdev -smallClusterHub=pk -bigClusterHub=swarm \
 	> net.log 2>&1 &
     #	real    81m20.209s
     #	continuing with the load and adding syntenicNet
     time nice -n +19 doBlastzChainNet.pl `pwd`/DEF -verbose=2 -continue=load \
 	-syntenicNet -noLoadChainSplit -chainMinScore=5000 \
 	-chainLinearGap=medium \
 	-workhorse=hgwdev -smallClusterHub=pk -bigClusterHub=swarm \
 	> load.log 2>&1 &
     #	real    47m17.871s
 
     #	running the swap
     ssh swarm
     mkdir /hive/data/genomes/panTro2/bed/blastz.hg19.swap
     cd /hive/data/genomes/panTro2/bed/blastz.hg19.swap
     time nice -n +19 doBlastzChainNet.pl -verbose=2 \
 	-swap /hive/data/genomes/hg19/bed/lastzPanTro2.2009-03-19/DEF \
 	-noLoadChainSplit -chainMinScore=5000 -chainLinearGap=medium \
 	-workhorse=hgwdev -smallClusterHub=swarm -bigClusterHub=swarm \
 	> swap.log 2>&1 &
     #	real    723m41.377s
     cat fb.panTro2.chainHg19Link.txt 
     #	2761343871 bases of 2909485072 (94.908%) in intersection
 
 ############################################################################
 # Creating the pushQ entry (DONE - 2009-03-20 - Hiram)
     mkdir /hive/data/genomes/hg19/pushQ
     cd /hive/data/genomes/hg19/pushQ
     makePushQSql.pl hg19 > hg19.pushQ.sql 2> make.err
     # many complaints about the chain and net tables from the haplotype
     #	experiments, and this table:
     #	orfeomeGenes
     #	which is probably in genbank, and these usual ones:
     #	hg19 does not have seq
     #	hg19 does not have extFile
 
 ############################################################################
 # Determine PAR region of X and Y (DONE - 2009-03-20 - Hiram)
     mkdir /hive/data/genomes/hg19/bed/parRegion
     cd /hive/data/genomes/hg19/bed/parRegion
     awk '$5 != "N"' ../../X/chrX.agp | awk '{print $6}' | sort > chrX.cloneList
     awk '$5 != "N"' ../../Y/chrY.agp | awk '{print $6}' | sort > chrY.cloneList
     comm -12 chrX.cloneList chrY.cloneList > chrXY.par.clone.list
     cat chrXY.par.clone.list \
 	| while read C; do grep "${C}" ../../X/chrX.agp; done \
 	| sort -k1,1 -k2,2n >> chrX.par.region.agp
     cat chrXY.par.clone.list \
 	| while read C; do grep "${C}" ../../Y/chrY.agp; done \
 	| sort -k1,1 -k2,2n >> chrY.par.region.agp
     awk '{printf "%s\t%d\t%d\t%s\n", $1, $2-1, $3, $6}' chrY.par.region.agp \
 	> chrY.par.region.bed
     awk '{printf "%s\t%d\t%d\t%s\n", $1, $2-1, $3, $6}' chrX.par.region.agp \
 	> chrX.par.region.bed
     #	use those bed files in custom tracks on hg19 to verify that they
     #	are two continuous regions with only gaps between these items
     #	these location extents are: (zero relative)
     #	chrX 60000 2722842
     #	chrX 154906585 155260560
     #	chrY 10000 2649520
     #	chrY 59034049 59363566
 
 ############################################################################
 # Gorilla Lastz run (WORKING - 2009-03-21 - Hiram)
     mkdir /hive/data/genomes/hg19/bed/lastzGorGor1.2009-03-21
     cd /hive/data/genomes/hg19/bed/lastzGorGor1.2009-03-21
     cat << '_EOF_'
 # human vs gorilla
 BLASTZ=lastz
 # maximum M allowed with lastz is only 254
 BLASTZ_M=254
 # lastz does not like the O= and E= lines in the matrix file
 #       this copy has that removed from /scratch/data/scratch/human_chimp.v2.q
 BLASTZ_Q=/hive/data/genomes/hg19/bed/lastzHg19Haps.2009-03-09/human_chimp.v2.q
 # and place those items here
 BLASTZ_O=600
 BLASTZ_E=150
 # other parameters from panTro2 vs hg18 lastz on advice from Webb
 BLASTZ_K=4500
 BLASTZ_Y=15000
 BLASTZ_T=2
 
 # TARGET: Human Hg19
 SEQ1_DIR=/scratch/data/hg19/hg19.2bit
 SEQ1_LEN=/scratch/data/hg19/chrom.sizes
 SEQ1_CHUNK=100000000
 SEQ1_LAP=10000
 SEQ1_IN_CONTIGS=0
 
 # QUERY: Gorilla gorGor1
 SEQ2_DIR=/scratch/data/gorGor1/gorGor1.2bit
 SEQ2_LEN=/scratch/data/gorGor1/chrom.sizes
 SEQ2_CHUNK=20000000
 SEQ2_LIMIT=300
 SEQ2_LAP=0
 SEQ2_IN_CONTIGS=0
 
 BASE=/hive/data/genomes/hg19/bed/lastzGorGor1.2009-03-21
 TMPDIR=/scratch/tmp
 '_EOF_'
     # << happy emacs
 
     screen # use screen to manage this long-running job
     time nice -n +19 doBlastzChainNet.pl `pwd`/DEF -verbose=2 \
 	-noLoadChainSplit -chainMinScore=5000 -chainLinearGap=medium \
 	-workhorse=hgwdev -smallClusterHub=pk -bigClusterHub=swarm \
 	> do.log 2>&1 &
 # XXX running 
 Sat Mar 21 22:22:18 PDT 2009
 
 ############################################################################
 # PREPARE LINEAGE SPECIFIC REPEAT FILES FOR BLASTZ (DONE - 2009-04-02 - Hiram)
     ssh pk
     mkdir /hive/data/genomes/hg19/bed/linSpecRep
     cd /hive/data/genomes/hg19/bed/linSpecRep
     #	create individual .out files from the master record in ../repeatMasker
     mkdir splitOut
     cat << '_EOF_' > split.csh
 #!/bin/csh -fe
 set C = $1
 head -3 ../repeatMasker/hg19.clean.out > splitOut/${C}.out
 grep "${C} " ../repeatMasker/hg19.clean.out >> splitOut/${C}.out
 '_EOF_'
     # << happy emacs
 
     cat << '_EOF_' > template
 #LOOP
 split.csh $(root1) {check out line+ splitOut/$(root1).out}
 #ENDLOOP
 '_EOF_'
     # << happy emacs
 
     cut -f1 ../../chrom.sizes > chrom.list
     gensub2 chrom.list single template jobList
     para create jobList
     para try ... check ... push ... etc...
 # Completed: 93 of 93 jobs
 # CPU time in finished jobs:        127s       2.12m     0.04h    0.00d  0.000 y
 # IO & Wait Time:                 17154s     285.90m     4.76h    0.20d  0.001 y
 # Average job time:                 186s       3.10m     0.05h    0.00d
 # Longest finished job:             224s       3.73m     0.06h    0.00d
 # Submission to last job:           280s       4.67m     0.08h    0.00d
     
     #	now, we can date and process each of those .out files
     #	this really should be a single creation of notInOthers
     #	These four different ones all end up to be the same anyhow
     #	the notInMouse becomes notInOthers below and the others are removed.
     mkdir dateRepeats
     cd dateRepeats
     cat << '_EOF_' > mkLSR
 #!/bin/csh -fe
 rm -f $1.out_mus-musculus_rattus_canis-familiaris_bos-taurus
 ln -s ../splitOut/$1.out .
 /scratch/data/RepeatMasker/DateRepeats \
     $1.out -query human -comp mouse -comp rat -comp dog -comp cow
 rm $1.out
 mkdir -p ../notInMouse ../notInRat ../notInDog ../notInCow
 /cluster/bin/scripts/extractRepeats 1 $1.out_mus*-taurus \
 	> ../notInMouse/$1.out.spec
 /cluster/bin/scripts/extractRepeats 2 $1.out_mus*-taurus \
 	> ../notInRat/$1.out.spec
 /cluster/bin/scripts/extractRepeats 3 $1.out_mus*-taurus \
 	> ../notInDog/$1.out.spec
 /cluster/bin/scripts/extractRepeats 4 $1.out_mus*-taurus \
 	> ../notInCow/$1.out.spec
 '_EOF_'
     #	<< happy emacs
     chmod +x mkLSR
 
     cat << '_EOF_' > template
 #LOOP
 ./mkLSR $(path1) {check out line+ $(path1).out_mus-musculus_rattus_canis-familiaris_bos-taurus}
 #ENDLOOP
 '_EOF_'
     #	<< happy emacs
 
     gensub2 ../chrom.list single template jobList
     para try ... check ... push ... etc...
     para time
 # Completed: 93 of 93 jobs
 # CPU time in finished jobs:       2441s      40.69m     0.68h    0.03d  0.000 y
 # IO & Wait Time:                   332s       5.53m     0.09h    0.00d  0.000 y
 # Average job time:                  30s       0.50m     0.01h    0.00d
 # Longest finished job:             125s       2.08m     0.03h    0.00d
 # Submission to last job:           454s       7.57m     0.13h    0.01d
 
     done
 
     #	these four types of out.spec results all turn out to be identical
     #	To check identical
     cd /hive/data/genomes/hg19/bed/linSpecRep
     find . -name "*.out.spec" | \
 	while read FN; do echo `cat ${FN} | sum -r` ${FN}; done \
 	| sort -k1,1n | sort -t"/" -k3,3 | sed -e "s#./notIn.*/##" \
 	| sort | uniq -c | less
     #	You will see they are all a count of 4
     #	Set them up on scratch data and get to all the kluster nodes:
     mkdir /hive/data/staging/data/hg19/lineageSpecificRepeats
     cd notInMouse
     rsync -a --progress ./ /hive/data/staging/data/hg19/lineageSpecificRepeats
     cd ..
     mv notInMouse notInOthers
     #	do not need to keep all of these
     rm -fr notInRat notInDog notInCow
 
     # We also need the nibs for blastz runs with lineage specific repeats
     mkdir /hive/data/genomes/hg19/bed/nibs
     cd /hive/data/genomes/hg19/bed/nibs
     cut -f1 ../../chrom.sizes | while read C
 do
     twoBitToFa -seq=${C} ../../hg19.2bit stdout \
 	| faToNib -softMask stdin ${C}.nib
     echo "${C} done"
 done
     mkdir /hive/data/staging/data/hg19/nib
     rsync -a --progress ./ /hive/data/staging/data/hg19/nib
 
     # Ask cluster-admin to sync /scratch/ filesystem to kluster nodes
 
 #############################################################################
 # create gc5Base download file (DONE - 2009-04-24 - Hiram)
     cd /hive/data/genomes/hg19/bed/gc5Base
     hgGcPercent -wigOut -doGaps -file=stdout -win=5 -verbose=0 hg19 \
         /cluster/data/hg19/hg19.2bit | gzip -c > hg19.gc5Base.txt.gz
 
 #############################################################################
 # Physical Map Contigs - ctgPos (DONE - 2009-04-23 - Hiram)
     mkdir /hive/data/genomes/hg19/bed/ctgPos
     cd /hive/data/genomes/hg19/bed/ctgPos
     cat << '_EOF_' > mkCtgPos.sh
 AGP="/hive/data/genomes/hg19/download/assembled_chromosomes/AGP"
 export AGP
 for F in `(cd ${AGP}; ls chr*.agp | grep -v ".comp.agp")`
 do
     C=${F/.agp/}
     grep "^CM" "${AGP}/${F}" | awk '$5 != "N"' | awk '
 {
 printf "%s\t%d\t%s\t%d\t%d\n", $6, $8-$7+1, "'${C}'", $2-1+$7-1, $2-1+$8
 }
 '
 done
 '_EOF_'
     # << happy emacs
     chmod +x mkCtgPos.sh
     ./mkCtgPos.sh > ctgPos.tab
 
     cat << '_EOF_' > mkRanCtgPos.sh
 AGP="/hive/data/genomes/hg19/download/unlocalized_scaffolds/AGP"
 export AGP
 for F in `(cd ${AGP}; ls chr*.agp)`
 do
     C=${F/.unlocalized.scaf.agp/}
     c=${C/chr/}
     export C c
     grep "^GL" "${AGP}/${F}" | awk '$5 != "N"' | awk '
 BEGIN {
     ctgName=""
     ctgStart=0
     ctgEnd=0
     chrom="'${c}'"
     ctgNameLower=""
 }
 {
 if (match(ctgName,$1)) {
     ctgEnd = $3
 } else {
     if (length(ctgName) > 0) {
         size=ctgEnd - ctgStart
 printf "%s\t%d\tchr%s_%s_random\t%d\t%d\n", ctgName, size, chrom, ctgNameLower, 
 ctgStart, ctgEnd
     }
     ctgStart = $2 - 1
     ctgEnd = $3
     ctgName = $1
     ctgNameLower = tolower($1)
     sub(".1$","",ctgNameLower)
 }
 }
 END {
 size=ctgEnd - ctgStart
 printf "%s\t%d\tchr%s_%s_random\t%d\t%d\n", ctgName, size, chrom, ctgNameLower, 
 ctgStart, ctgEnd
 }
 '
 done
 '_EOF_'
     # << happy emacs
     chmod +x mkRanCtgPos.sh
     ./mkRanCtgPos.sh >> ctgPos.tab
 
     #	fetch .sql definition from hg18
     chmod 777 .
     hgsqldump --all -c --tab=. hg18 ctgPos
     chmod 775 .
     hgsql hg19 < ctgPos.sql
     hgsql -e 'load data local infile "ctgPos.tab" into table ctgPos;' hg19
 
 #############################################################################
 # CLONE ENDS - first step for BACEND/CytoBand tracks
 #	(DONE - 2009-04-28 - Hiram)
     mkdir -p /hive/data/genomes/hg19/bed/cloneend/ncbi
     cd /hive/data/genomes/hg19/bed/cloneend/ncbi
 
     wget --timestamping \
 'ftp://ftp.ncbi.nih.gov/genomes/CLONEEND/homo_sapiens/9606_clone_ends*.mfa.gz'
     wget --timestamping \
 'ftp://ftp.ncbi.nih.gov/genomes/CLONEEND/homo_sapiens/9606_clone_info*.txt.gz'
 
     cd /hive/data/genomes/hg19/bed/cloneend
     # seems like the *.mfa files were split just for convenience
     # concatenate
 
     for F in ncbi/*.mfa.gz
 do
     zcat "${F}"
     echo "${F}" 1>&2
 done | gzip > all.mfa.gz
     #	that 1>&2 echos to stderr so you can see the file name and not
     #	interfere with the pipe stdout output to gzip
 
     # Convert the title line of the all.mfa file
     zcat all.mfa.gz \
 	| sed -e "s#^>gi.[0-9]*.gb.#>#; s#^>gi.[0-9]*.emb.#>#; s#\.[0-9]|.*##" \
 	    | gzip > cloneEnds.fa.gz
 
     zcat all.mfa | ./convert.pl | gzip > cloneEnds.fa.gz
 
     #	make sure nothing got broken:
     faSize all.mfa.gz
 # 400901385 bases (5941742 N's 394959643 real 255835696 upper 139123947 lower)
 # in 833173 sequences in 1 files
 
     faSize cloneEnds.fa.gz
 # 400901385 bases (5941742 N's 394959643 real 255835696 upper 139123947 lower)
 # in 833173 sequences in 1 files
 
     #	identical numbers
     #	you can also carefully check the names:
     zcat all.mfa.gz | grep "^>" | awk -F'|' '{print $4}' \
 	| sed -e "s/\.[0-9]$//" | sort > mfa.names
     #	should be the same as:
     zcat cloneEnds.fa.gz | grep "^>" | sed -e "s/>//" | sort > clone.names
 
 
     # concatenate the text files, too
     bash
     for F in ncbi/*.txt.gz
 do
     zcat "${F}"
     echo "${F}" 1>&2
 done | gzip > all.txt.gz
 
     # generate cloneEndPairs.txt and cloneEndSingles.txt
     zcat all.txt.gz >all.txt
     $HOME/kent/src/hg/utils/cloneEndParse.pl all.txt
 
     #	Reading in end info
     #	Writing out pair info
     #	Writing out singleton info
     #	302264 pairs and 203094 singles
     #	examined all the clone names and all the bac end names in these two
     #	files and compared with business from all.txt to make sure we properly
     #	classified all of them correctly.  We had 833,173 clone sequences,
     #	and 501,135 bac end names
 
     #	faSplit does not function correctly if given a .gz source file
     #	AND, we need the unzipped file for sequence loading below
     gunzip cloneEnds.fa.gz
     # split
     mkdir splitdir
     cd splitdir
     faSplit sequence ../cloneEnds.fa 100 cloneEnds
     #	Check to ensure no breakage:
     cat *.fa | faSize stdin
 # 400901385 bases (5941742 N's 394959643 real 255835696 upper 139123947 lower)
 # in 833173 sequences in 1 files
     #	same numbers as before
 
     # load sequences
     ssh hgwdev
     mkdir /gbdb/hg19/cloneend
     cd /gbdb/hg19/cloneend
       ln -s /hive/data/genomes/hg19/bed/cloneend/cloneEnds.fa .
     cd /tmp
     hgLoadSeq hg19 /gbdb/hg19/cloneend/cloneEnds.fa
     #  Advisory lock created
     # Creating .tab file
     # Adding /gbdb/hg19/cloneend/cloneEnds.fa
     # 833173 sequences
     # Updating seq table
     # Advisory lock has been released
     # All done
 
 ##############################################################################
 # BACEND SEQUENCE ALIGNMENTS (WORKING - 2009-04-28 - Hiram)
     mkdir -p /hive/data/genomes/hg19/bed/bacends/run.blat
     cd /hive/data/genomes/hg19/bed/bacends/run.blat
     #	going to run separate runs for the golden path sequence vs. the
     #	randoms, haplotypes, chrUn and chrM
     partitionSequence.pl 5000000 20000 /scratch/data/hg19/hg19.2bit \
 	/scratch/data/hg19/chrom.sizes 100 -xdir xdir.sh -lstDir tParts \
 	| egrep -v "tParts|random|_hap|chrUn" \
 	| sed -e "s/.*2bit://; s/:/./" > hg19.list
     ls -1S /hive/data/genomes/hg19/bed/cloneend/splitdir/cloneEnds*.fa \
 	> bacEnds.list
 
     ssh swarm
     cd /hive/data/genomes/hg19/bed/bacends/run.blat
 
     cat > template << '_EOF_'
 #LOOP
 runOne.csh $(file1) $(path2) {check out line+ psl/$(root1)/$(file1).$(root2).psl}
 #ENDLOOP
 '_EOF_'
     # << happy emacs
     cat > runOne.csh << '_EOF_'
 #!/bin/csh -fe
 
 set target = $1
 set query = $2
 set result = $3
 set partSpec = `echo $target | sed -e "s/\./:/"`
 set start = `echo $partSpec | sed -e "s/.*://; s/-/ /" | awk '{print $1}'`
 set end = `echo $partSpec | sed -e "s/.*://; s/-/ /" | awk '{print $2}'`
 set range = `echo $start $end | awk '{print $2-$1}'`
 set dir = $result:h
 set chr = `echo $target | sed -e "s/\..*//"`
 set chrSize = `grep -P "^$chr\t" /scratch/data/hg19/chrom.sizes | cut -f2`
 set tmpFile = `echo $result | sed -e "s#psl/$chr/#/scratch/tmp/#; s/.psl//"`
 
 # echo $tmpFile
 # echo "chr: $chr $start $end -> size: $chrSize, range: $range"
 /bin/echo -e "$start\t$partSpec\t$range\t$chr\t$chrSize" > $tmpFile.lift
 /bin/mkdir -p $dir
 /cluster/bin/x86_64/blat -ooc=/scratch/data/hg19/11.ooc \
         /scratch/data/hg19/hg19.2bit:$partSpec $query $tmpFile.psl
 rm -f $result
 liftUp -type=.psl $result $tmpFile.lift error $tmpFile.psl
 rm -f $tmpFile.lift $tmpFile.psl
 '_EOF_'
     # << happy emacs
 
     gensub2 hg19.list bacEnds.list template jobList
     para create jobList
 # 62034 jobs in batch
     # these jobs run quickly, limit them to 250 at a time
     para try, check, -maxJob=250 push, etc ...
 # Completed: 62034 of 62034 jobs
 # CPU time in finished jobs:     506023s    8433.72m   140.56h    5.86d  0.016 y
 # IO & Wait Time:                175853s    2930.88m    48.85h    2.04d  0.006 y
 # Average job time:                  11s       0.18m     0.00h    0.00d
 # Longest finished job:             752s      12.53m     0.21h    0.01d
 # Submission to last job:          3533s      58.88m     0.98h    0.04d
 
     #	combine the alignments
     time pslSort dirs raw.psl temp psl/chr*
     #	62034 files in 24 dirs
     #	Got 62034 files 249 files per mid file
     #	real    81m2.820s
 
     #	-rw-rw-r--  1 13410334441 Apr 29 12:00 raw.psl
     # cleanup
     rmdir temp
 
     time pslReps -nearTop=0.02 -minCover=0.60 -minAli=0.85 -noIntrons \
                 raw.psl  bacEnds.psl /dev/null > pslReps.out 2>&1 &
     #	real    5m55.990s
     #	Processed 106254032 alignments
     #	-rw-rw-r--  1   372734361 Apr 29 12:56 bacEnds.psl
 
 
     wc -l bacEnds.psl
     #	2852977 bacEnds.psl
 
     time pslPairs -tInsert=10000 -minId=0.91 -noBin -min=25000 -max=350000 \
 	-slopval=10000 -hardMax=500000 -slop -short -long -orphan \
 	-mismatch -verbose bacEnds.psl \
 	/cluster/data/hg19/bed/cloneend/cloneEndPairs.txt \
 	all_bacends bacEnds
     #	Reading pair file
     #	Reading psl file
     #	Creating Pairs
     #	Writing to files
     #	real    0m18.851s
     #	this creates the files:
     #	-rw-rw-r--  1    21178741 Apr 29 13:00 bacEnds.pairs
     #	-rw-rw-r--  1     5250873 Apr 29 13:00 bacEnds.orphan
     #	-rw-rw-r--  1      738045 Apr 29 13:00 bacEnds.short
     #	-rw-rw-r--  1      463560 Apr 29 13:00 bacEnds.slop
     #	-rw-rw-r--  1      146369 Apr 29 13:00 bacEnds.mismatch
     #	-rw-rw-r--  1        3528 Apr 29 13:00 bacEnds.long
 
     # filter and sort
     awk '$5 >= 300' bacEnds.pairs | sort -k1,1 -k2,2n > bacEndPairs.bed
     awk '$5 >= 300' bacEnds.slop bacEnds.short bacEnds.long \
 	bacEnds.mismatch bacEnds.orphan | sort -k1,1 -k2,2n > bacEndPairsBad.bed
 
     extractPslLoad -noBin bacEnds.psl bacEndPairs.bed \
 	bacEndPairsBad.bed | headRest 2 stdin | sort -k14,14 -k16,16n \
 	    > bacEndPairs.load.psl
 
 ############################################################################
 # BACEND Randoms SEQUENCE ALIGNMENTS (WORKING - 2009-04-28 - Hiram)
     mkdir -p /hive/data/genomes/hg19/bed/bacends/run.randoms
     cd /hive/data/genomes/hg19/bed/bacends/run.randoms
     #	this separate run for the randoms, haplotypes, chrUn and chrM
     partitionSequence.pl 5000000 20000 /scratch/data/hg19/hg19.2bit \
 	/scratch/data/hg19/chrom.sizes 100 -xdir xdir.sh -lstDir tParts \
 	| egrep "random|_hap|chrUn" \
 	| sed -e "s/.*2bit://; s/:/./" > random.list
     cat tParts/*.lst | sed -e "s/.*2bit://; s/:/./" >> random.list
 
     ls -1S /hive/data/genomes/hg19/bed/cloneend/splitdir/cloneEnds*.fa \
 	> bacEnds.list
 
     ssh swarm
     cd /hive/data/genomes/hg19/bed/bacends/run.randoms
     gensub2 random.list bacEnds.list ../run.blat/template jobList
     # very similar runOne.csh script as above, but it doesn't need to do
     #	the lift
     cat > runOne.csh << '_EOF_'
 #!/bin/csh -fe
 
 set target = $1
 set query = $2
 set result = $3
 set partSpec = `echo $target | sed -e "s/\./:/"`
 set start = `echo $partSpec | sed -e "s/.*://; s/-/ /" | awk '{print $1}'`
 set end = `echo $partSpec | sed -e "s/.*://; s/-/ /" | awk '{print $2}'`
 set range = `echo $start $end | awk '{print $2-$1}'`
 set dir = $result:h
 set chr = `echo $target | sed -e "s/\..*//"`
 set chrSize = `grep -P "^$chr\t" /scratch/data/hg19/chrom.sizes | cut -f2`
 set tmpFile = `echo $result | sed -e "s#psl/$chr/#/scratch/tmp/#; s/.psl//"`
 
 # echo $tmpFile
 # echo "chr: $chr $start $end -> size: $chrSize, range: $range"
 /bin/echo -e "$start\t$partSpec\t$range\t$chr\t$chrSize" > $tmpFile.lift
 /bin/mkdir -p $dir
 /cluster/bin/x86_64/blat -ooc=/scratch/data/hg19/11.ooc \
         /scratch/data/hg19/hg19.2bit:$partSpec $query $tmpFile.psl
 rm -f $result
 mv $tmpFile.psl $result
 echo rm -f $tmpFile.lift
 '_EOF_'
     # << happy emacs
 
     # these jobs run fast, do not let too many of them run
     para -maxJob=100 try...check...push
     para time
 # Completed: 6762 of 6762 jobs
 # CPU time in finished jobs:      20357s     339.29m     5.65h    0.24d  0.001 y
 # IO & Wait Time:                 17839s     297.31m     4.96h    0.21d  0.001 y
 # Average job time:                   6s       0.09m     0.00h    0.00d
 # Longest finished job:             261s       4.35m     0.07h    0.00d
 # Submission to last job:           508s       8.47m     0.14h    0.01d
 
     time pslSort dirs raw.psl temp psl/chr*
     #	6762 files in 69 dirs
     #	Got 6762 files 82 files per mid file
     #	real    6m37.177s
 
     #	37044 files in 98 dirs
     #	Got 37044 files 192 files per mid file
     #	real    32m24.804s
     #	-rw-rw-r--    1 6487445210 Feb  2 21:08 raw.psl
     time pslReps -nearTop=0.02 -minCover=0.60 -minAli=0.85 -noIntrons \
                 raw.psl randomEnds.psl randomReps.psr > pslReps.out 2>&1 &
     #	real    0m5.761s
     #	Processed 1254273 alignments
 
     # cleanup
     rmdir temp
 
     wc -l randomEnds.psl
     #	367567 randomEnds.psl
 
     time pslPairs -tInsert=10000 -minId=0.91 -noBin -min=25000 -max=350000 \
 	-slopval=10000 -hardMax=500000 -slop -short -long -orphan \
 	-mismatch -verbose randomEnds.psl \
 	/cluster/data/hg19/bed/cloneend/cloneEndPairs.txt \
 	all_bacends bacEnds
     #	Reading pair file
     #	Reading psl file
     #	Creating Pairs
     #	Writing to files
     #	real    0m11.221s
     #	this creates the files:
     #	-rw-rw-r--  1         0 Apr 29 14:53 bacEnds.slop
     #	-rw-rw-r--  1         0 Apr 29 14:53 bacEnds.short
     #	-rw-rw-r--  1         0 Apr 29 14:53 bacEnds.mismatch
     #	-rw-rw-r--  1         0 Apr 29 14:53 bacEnds.long
     #	-rw-rw-r--  1    141836 Apr 29 14:53 bacEnds.pairs
     #	-rw-rw-r--  1    649907 Apr 29 14:53 bacEnds.orphan
 
 ##############################################################################
 # BacEnds track - both results loaded together (DONE - 2009-04-29 - Hiram)
     ssh hgwdev
     cd /hive/data/genomes/hg19/bed/bacends
     # filter and sort
     awk '$5 >= 300' run.blat/bacEnds.pairs run.randoms/bacEnds.pairs \
 	| sort -k1,1 -k2,2n > bacEndPairs.bed
     awk '$5 >= 300' run.blat/bacEnds.slop run.blat/bacEnds.short \
 	run.blat/bacEnds.long run.blat/bacEnds.mismatch \
 	run.blat/bacEnds.orphan run.randoms/bacEnds.slop \
 	run.randoms/bacEnds.short run.randoms/bacEnds.long \
 	run.randoms/bacEnds.mismatch run.randoms/bacEnds.orphan \
 	    | sort -k1,1 -k2,2n > bacEndPairsBad.bed
 
     head -5 run.blat/bacEnds.psl > bacEnds.psl
     headRest 5 run.blat/bacEnds.psl > t.psl
     headRest 5 run.randoms/randomEnds.psl >> t.psl
     sort -k14,14 -k16,16n t.psl >> bacEnds.psl
     extractPslLoad -noBin bacEnds.psl bacEndPairs.bed \
 	bacEndPairsBad.bed | headRest 2 stdin | sort -k14,14 -k16,16n \
 	    > bacEnds.load.psl
 
 
     #	load them into the database
     ssh hgwdev
     cd /hive/data/genomes/hg19/bed/bacends
     #	CHECK bacEndPairs.bed ID's to make sure they have no blanks in them
     awk '{print $4}' bacEndPairs.bed | grep " "
     awk '{print $5}' bacEndPairs.bed | sort | uniq -c
     #	result should be the scores, no extraneous strings:
     #	156984 1000
     #	   195 300
     #	   316 375
     #	   297 500
     #	  1476 750
     #	edit the file and fix it if it has a bad name.
     hgLoadBed -notItemRgb hg19 bacEndPairs bacEndPairs.bed \
                  -sqlTable=$HOME/kent/src/hg/lib/bacEndPairs.sql
     #	Loaded 208922 elements of size 11
     # note - this track isn't pushed to RR, just used for assembly QA
     hgLoadBed -notItemRgb hg19 bacEndPairsBad bacEndPairsBad.bed \
                  -sqlTable=$HOME/kent/src/hg/lib/bacEndPairsBad.sql
     #	Loaded 79004 elements of size 11
     #hgLoadPsl hg18 -nobin -table=all_bacends bacEnds.load.psl
     # NOTE: truncates file to 0 if -nobin is used
     hgLoadPsl hg19 -table=all_bacends bacEnds.load.psl
     # one complaint, there appears to be a bogus insert count in one
     #	of the blat results:
 # < 585   797     67      0       3       2       -63     9       79188   +      AQ743980 852     42      846     chr19_gl000208_random   92689   4045    84100  11       14,124,84,496,53,6,20,28,28,10,4,       42,56,180,200,696,750,756,776,804,832,842,      4045,5767,7086,83449,83946,83999,84006,84027,84056,84085,84096,
 Became:
 # > 585   797     67      0       3       2       0       9       79188   +	 AQ743980 852     42      846     chr19_gl000208_random   92689   4045	84100  11       14,124,84,496,53,6,20,28,28,10,4,	42,56,180,200,696,750,756,776,804,832,842,	4045,5767,7086,83449,83946,83999,84006,84027,84056,84085,84096,
 
     hgsql -N -e "select count(*) from all_bacends;" hg19
     #	 2289275
     hgsql -N -e "select count(*) from all_bacends;" hg18
     #	1727387
     hgsql -N -e "select count(*) from all_bacends;" hg17
     #	 1729146
 
     nice featureBits hg19 all_bacends
 # 230917362 bases of 2897316137 (7.970%) in intersection
     nice featureBits hg18 all_bacends
 # 227770876 bases of 2881515245 (7.905%) in intersectio
     nice featureBits hg17 all_bacends
 # 225763317 bases of 2866216770 (7.877%) in intersection
 
     nice featureBits hg19 bacEndPairs
 # 236889607 bases of 2897316137 (8.176%) in intersection
     nice featureBits hg18 bacEndPairs
 # 162690030 bases of 2881515245 (5.646%) in intersection
     nice featureBits hg17 bacEndPairs
 # 162099487 bases of 2866216770 (5.656%) in intersection
 
     nice featureBits hg19 bacEndPairsBad
 # 38344094 bases of 2897316137 (1.323%) in intersection
     nice featureBits hg18 bacEndPairsBad
 # 37326990 bases of 2881515245 (1.295%) in intersection
     nice featureBits hg17 bacEndPairsBad
 # 37437558 bases of 2866216770 (1.306%) in intersection
 
 ############################################################################
 # STS MARKERS (DONE - 2009-04-30 - 2009-05-06 - Hiram)
     mkdir /hive/data/outside/ncbi/sts.2009-04
     cd /hive/data/outside/ncbi
     ln -s sts.2009-04 sts.11
     cd /hive/data/outside/ncbi/sts.2009-04
     wget --timestamping ftp://ftp.ncbi.nih.gov/repository/UniSTS/UniSTS.sts
     wget --timestamping ftp://ftp.ncbi.nih.gov/repository/UniSTS/UniSTS.aliases
     wget --timestamping ftp://ftp.ncbi.nih.gov/blast/db/FASTA/sts.gz
     gunzip sts.gz
     mv sts dbSTS.fa
 
     #	these items are copied in from the previous builds
     cp -p /cluster/data/ncbi/sts.10/all.STS.fa ./all.STS.fa.prev
     cp -p /cluster/data/ncbi/sts.10/stsInfo2.bed ./stsInfo2.bed.prev
     #	edit stsInfo2.bed.prev for a
     #	manual fixup of error that is in the hg18 bed file, replace
     #	the line for AFM067XA9 to fix bogus long list of aliases to be:
 # 22788^IAFM067XA9^I1^IZ66598^I1^IGDB:1221611,^I5^I067XA9,GDB:1221611,W202,Z66598,SWSS2303^I69047^I0^I^ITCTTGGGGTTTAATTGCTTT^ICTTTGCCACAATCTTACACA^I149^IHomo sapiens^I1^I2^I6453,6454,^I0^I^I^I^I0^I0^I^I^I0^I0^IAFM067XA9^Ichr7^I145^I0^I^I^I0^I0^I^I^I0^I0^I^I^I0^I0^I^I^I0^I0^I^I^I0^I0
     #	as taken directly out of the hg18.stsInfo2 table which was fixed
     #	by Bob and Archana
 
     # Convert the title line of the dbSTS.fa file
     #	Verify that column 3 only contains gb emb dbj
     grep "^>" dbSTS.fa | awk -F'|' '{print $3}' | sort | uniq -c 
 #   39124 dbj
 #   57375 emb
 # 1212541 gb
     #	if that is true, this sed will work:
     cat dbSTS.fa \
 	| sed -e "s#^>gi.[0-9]*.gb.#>#; s#^>gi.[0-9]*.emb.#>#; s#^>gi.[0-9]*.dbj.#>#; s#\.[0-9]|.*##" \
 	    > UniSTS.convert.fa
 
     # get accessions
     grep ">" UniSTS.convert.fa | sed -e "s/^>//" | sort > UniSTS.acc
     #	head and tail that to ensure names are reasonable, odd names would
     #	show up at the beginning or end
     wc -l UniSTS.acc
     #	1309040 UniSTS.acc
 
     # NOTE: updateStsInfo creates new stsInfo2.bed, all.primers,
     #   all.STS.fa, stsAlias.bed files
 
     updateStsInfo -verbose=1 -gb=UniSTS.acc stsInfo2.bed.prev all.STS.fa.prev \
 	UniSTS.sts UniSTS.aliases UniSTS.convert.fa new
 
     #	verify the number of aliases is reasonable:
     awk '{print $3}' new.alias | sort | uniq -c | sort -rn | less
     #	50 D7S831
     #	34 CHLC.GATA2B06.465
     #	24 CHLC.GATA11E11
     #	23 AFM276ZF5
     #	23 AFM273YH9
     #	22 SHGC-133043
     #	... etc ...
     #	verify there are no unusually long or short lines:
     awk '{printf "%d\n", length($0)}' new.info | sort -n | head -3
     #	143
     #	144
     #	144
     awk '{printf "%d\n", length($0)}' new.info | sort -n | tail -3
     #	552
     #	553
     #	644
     # check for null in the new files:
     grep -i null new.*
     #	if the new files look good, they can become the set to use:
     mv new.info stsInfo2.bed
     mv new.primers all.primers
     mv new.alias stsAlias.bed
     mv new.fa all.STS.fa
 
     # get list of all STS id's in the fasta file
     sed -n 's/^>\([0-9][0-9]*\) .*/\1/p' all.STS.fa | sort -n >  all.STS.id
     wc -l all.STS.id
     # 100520 total sequences
     # in hg18 this was: 93698 total sequences
     $HOME/kent/src/hg/stsMarkers/convertPrimerToFA all.primers > all.primers.fa
     # check that fasta file for unusual length sequences:
     faSize all.primers.fa
 # 97815329 bases (83677626 N's 14137703 real 14137703 upper 0 lower) in 317592 sequences in 1 files
 # Total size: mean 308.0 sd 279.3 min 40 (dbSTS_144) max 30000 (dbSTS_156892) median 244
 
     # Copy stsInfo2.bed and stsAlias.bed to data directory becuase
     # these will be loaded into the database later
     mkdir -p /hive/data/genomes/hg19/bed/sts
     cp -p stsInfo2.bed /hive/data/genomes/hg19/bed/sts/
     cp -p stsAlias.bed /hive/data/genomes/hg19/bed/sts/
 
     # Create sts sequence alignments
     mkdir /hive/data/genomes/hg19/bed/sts/split
 
     faSplit sequence all.STS.fa 100 /hive/data/genomes/hg19/bed/sts/split/sts
 
     ssh swarm
     mkdir /hive/data/genomes/hg19/bed/sts/run
     cd /hive/data/genomes/hg19/bed/sts/run
 
     #	going to run separate runs for the golden path sequence vs. the
     #	randoms, haplotypes, chrUn and chrM
     #	40,000,000 chunck sizes, 20,000 overlap
     partitionSequence.pl 40000000 20000 /scratch/data/hg19/hg19.2bit \
 	/scratch/data/hg19/chrom.sizes 100 -lstDir tParts \
 	| egrep -v "tParts|random|_hap|chrUn" \
 	| sed -e "s/.*2bit://;" > hg19.list
     ls -1S ../split > sts.list
 
     cat > template << '_EOF_'
 #LOOP
 runOne.csh $(file1) $(root2) {check out line+ psl/$(file1)/$(root2).psl}
 #ENDLOOP
 '_EOF_'
     # << happy emacs
 
     cat > runOne.csh << '_EOF_'
 #!/bin/csh -fe
 
 set partSpec = $1
 set query = $2.fa
 set result = $3
 set tmpFile = "/scratch/tmp/$1.$2"
 set start = `echo $partSpec | sed -e "s/.*://; s/-/ /" | awk '{print $1}'`
 set end = `echo $partSpec | sed -e "s/.*://; s/-/ /" | awk '{print $2}'`
 set range = `echo $start $end | awk '{print $2-$1}'`
 set chr = `echo $partSpec | sed -e "s/:.*//"`
 set chrSize = `grep -P "^$chr\t" /scratch/data/hg19/chrom.sizes | cut -f2`
 /bin/echo -e "$start\t$partSpec\t$range\t$chr\t$chrSize" > $tmpFile.lift
 /bin/mkdir -p psl/$partSpec
 /bin/rm -f $tmpFile
 /cluster/bin/x86_64/blat -ooc=/scratch/data/hg19/11.ooc \
     /scratch/data/hg19/hg19.2bit:$partSpec \
 	../split/${query} -stepSize=5 $tmpFile.psl
 /bin/rm -f $result
 /cluster/bin/x86_64/liftUp -type=.psl $result $tmpFile.lift error $tmpFile.psl
 # rm -f $tmpFile.lift $tmpFile.psl
 '_EOF_'
     # << happy emacs
     chmod +x runOne.csh
 
     gensub2 hg19.list sts.list template jobList
     #	these jobs run quickly, allow only 100 at a time
     para -maxJob=100 create jobList
 # 8367 jobs in batch
     para try ... check ... push ... etc
 # Completed: 8366 of 8366 jobs
 # CPU time in finished jobs:      89744s    1495.74m    24.93h    1.04d  0.003 y
 # IO & Wait Time:                 25467s     424.44m     7.07h    0.29d  0.001 y
 # Average job time:                  14s       0.23m     0.00h    0.00d
 # Longest finished job:              53s       0.88m     0.01h    0.00d
 # Submission to last job:          1592s      26.53m     0.44h    0.02d
 
     #	and, run the randoms as a separate run:
     mkdir /hive/data/genomes/hg19/bed/sts/run.randoms
     cd /hive/data/genomes/hg19/bed/sts/run.randoms
     partitionSequence.pl 40000000 20000 /scratch/data/hg19/hg19.2bit \
 	/scratch/data/hg19/chrom.sizes 100 -lstDir tParts \
 	| egrep "tParts|random|_hap|chrUn"
     cat tParts/* | sed -e "s/.*2bit://;" > hg19.list
     ls -1S ../split > sts.list
     cat > template << '_EOF_'
 #LOOP
 runOne.csh $(file1) $(root2) {check out line+ psl/$(file1)/$(root2).psl}
 #ENDLOOP
 '_EOF_'
     # << happy emacs
 
     cat > runOne.csh << '_EOF_'
 #!/bin/csh -fe
 
 set partSpec = $1
 set query = $2.fa
 set result = $3
 set tmpFile = "/scratch/tmp/$1.$2"
 /bin/mkdir -p psl/$partSpec
 /bin/rm -f $tmpFile
 /cluster/bin/x86_64/blat -ooc=/scratch/data/hg19/11.ooc \
     /scratch/data/hg19/hg19.2bit:$partSpec \
 	../split/${query} -stepSize=5 $tmpFile.psl
 /bin/rm -f $result
 mv $tmpFile.psl $result
 /bin/rm -f $tmpFile.psl
 '_EOF_'
     # << happy emacs
     chmod +x runOne.csh
 
     gensub2 hg19.list sts.list template jobList
     #	these jobs run quickly, allow only 100 at a time
     para -maxJob=100 create jobList
 # 6486 jobs in batch
     para try ... check ... push ... etc
 # Completed: 6486 of 6486 jobs
 # CPU time in finished jobs:       2206s      36.77m     0.61h    0.03d  0.000 y
 # IO & Wait Time:                 16505s     275.08m     4.58h    0.19d  0.001 y
 # Average job time:                   3s       0.05m     0.00h    0.00d
 # Longest finished job:              21s       0.35m     0.01h    0.00d
 # Submission to last job:           601s      10.02m     0.17h    0.01d
 
     # Compile sts sequence results
     ssh hgwdev
     cd /hive/data/genomes/hg19/bed/sts/run
     time pslSort dirs raw.psl temp psl/chr*
     #	8366 files in 89 dirs
     #	Got 8366 files 91 files per mid file
     #	real    8m50.714s
     #	-rw-rw-r--  1 810438277 May  1 11:45 raw.psl
     cd /hive/data/genomes/hg19/bed/sts/run.randoms
     time pslSort dirs raw.psl temp psl/chr*
     #	6486 files in 69 dirs
     #	Got 6486 files 81 files per mid file
     #	real    1m42.120s
     #	-rw-rw-r--  1 18378188 May  1 11:52 raw.psl
 
     rmdir temp
     cd /hive/data/genomes/hg19/bed/sts
     cat run*/raw.psl | egrep -v "^$|^psLayout|^match|^ |^-" \
 	| pslReps -nearTop=0.0001 -minCover=0.6 -minAli=0.8 -noIntrons stdin \
 	stsMarkers.psl /dev/null
     #	Processed 7412166 alignments
     #	-rw-rw-r-- 1 12031760 May  1 11:57 stsMarkers.psl
 
     $HOME/kent/src/hg/stsMarkers/extractPslInfo -h stsMarkers.psl
     # creates stsMarkers.psl.initial
     #	-rw-rw-r-- 1  4485053 May  1 12:06 stsMarkers.psl.initial
     wc -l stsMarkers.psl.initial
     #	101338  stsMarkers.psl.initial
     #	this command needs a chrom_names file to work correctly with this
     #	new style of layout for hg19:
     cd /hive/data/genomes/hg19
     cut -f1 chrom.sizes | sed -e "s/chr//" > chrom_names
     cd /hive/data/genomes/hg19/bed/sts
 
     $HOME/kent/src/hg/stsMarkers/findAccession.pl -agp stsMarkers.psl.initial \
 	/cluster/data/hg19
     wc -l stsMarkers.psl.initial.acc
     #	101338  stsMarkers.psl.initial.acc
 
     sort -k4,4n stsMarkers.psl.initial.acc > stsMarkers.final
 
     # determine found markers (4th field in file)
     cut -f 4 stsMarkers.final | sort -n -u > stsMarkers.found
     wc -l stsMarkers.found
     #	96472 stsMarkers.found
     #	out of 100520 total sequences from:
     wc -l /hive/data/outside/ncbi/sts.2009-04/all.STS.id
     #	There are lots of duplicates:
     wc -l stsMarkers.final
     #	101338 stsMarkers.final
     #	And a lot of them are just completely haywire:
     awk '$3-$2 < 1001' stsMarkers.final | wc -l
     #	98382
     #	filter out markers that are too long
     awk '$3-$2 < 1001' stsMarkers.final > stsMarkers.1K.size.filtered
 
     #  alignment of primers
     ssh swarm
     cd /hive/data/outside/ncbi/sts.2009-04
     awk '$0 !~ /[^ACGT0-9\-\t]/ && (length($2) > 10) && (length($3) > 10) {printf "dbSTS_%s\t%s\t%s\n", $1,$2,$3}' \
 	    all.primers > all.primers.ispcr
     mkdir primerAlign
     cd primerAlign
     mkdir split
     cd split
     split -l 5000 ../../all.primers.ispcr primer_
     ls > ../primer.list
 
     cd ..
     #	we need a 10.ooc file for this business
     time blat /scratch/data/hg19/hg19.2bit \
 	/dev/null /dev/null -tileSize=10 -makeOoc=10.ooc -repMatch=1024
 # Wrote 146902 overused 10-mers to 10.ooc
 # real    19m16.758s
 
     # separate runs for whole genome vs. randoms
     mkdir run
     cd run
     partitionSequence.pl 40000000 20000 /scratch/data/hg19/hg19.2bit \
 	/scratch/data/hg19/chrom.sizes 100 -lstDir tParts \
 	| egrep -v "tParts|random|_hap|chrUn" \
 	| sed -e "s/.*2bit://;" > hg19.list
     cat > runOne.csh << '_EOF_'
 #!/bin/csh -fe
 
 set partSpec = $1
 set primer = ../split/$2
 set result = $3
 set tmpFile = "/scratch/tmp/$1.$2"
 set start = `echo $partSpec | sed -e "s/.*://; s/-/ /" | awk '{print $1}'`
 set end = `echo $partSpec | sed -e "s/.*://; s/-/ /" | awk '{print $2}'`
 set range = `echo $start $end | awk '{print $2-$1}'`
 set chr = `echo $partSpec | sed -e "s/:.*//"`
 set chrSize = `grep -P "^$chr\t" /scratch/data/hg19/chrom.sizes | cut -f2`
 /bin/echo -e "$start\t$partSpec\t$range\t$chr\t$chrSize" > $tmpFile.lift
 /bin/mkdir -p psl/$partSpec
 /bin/rm -f $tmpFile.psl
 /cluster/bin/x86_64/isPcr -out=psl -minPerfect=2 -maxSize=5000 -tileSize=10 \
     -ooc=/hive/data/outside/ncbi/sts.2009-04/primerAlign/10.ooc -stepSize=5 \
 	/scratch/data/hg19/hg19.2bit:$partSpec $primer $tmpFile.psl
 /bin/rm -f $result
 /cluster/bin/x86_64/liftUp -type=.psl $result $tmpFile.lift error $tmpFile.psl
 rm -f $tmpFile.lift $tmpFile.psl
 '_EOF_'
     # << happy emacs
     chmod +x runOne.csh
 
     cat > template << '_EOF_'
 #LOOP
 runOne.csh $(file1) $(root2) {check out line+ psl/$(file1)/$(root2).psl}
 #ENDLOOP
 '_EOF_'
     # << happy emacs
 
     gensub2 hg19.list ../primer.list template jobList
     para create jobList
 # 5696 jobs in batch
     para try ... check ... push ... etc
 # Completed: 5696 of 5696 jobs
 # CPU time in finished jobs:     203899s    3398.32m    56.64h    2.36d  0.006 y
 # IO & Wait Time:                 22049s     367.48m     6.12h    0.26d  0.001 y
 # Average job time:                  40s       0.66m     0.01h    0.00d
 # Longest finished job:            5314s      88.57m     1.48h    0.06d
 # Submission to last job:          5418s      90.30m     1.50h    0.06d
 # Estimated complete:                 0s       0.00m     0.00h    0.00d
 
     #	sort and filter the results
     cd psl
     pslSort dirs raw.psl temp chr*
     #	5696 files in 89 dirs
     #	Got 5696 files 75 files per mid file
     #	-rw-rw-r-- 1 456802973 May  4 13:32 raw.psl
     cd ..
     mkdir filter
     pslQuickFilter -minMatch=26 -maxMismatch=5 \
         -maxTinsert=5000 -verbose psl/ filter/
     #	-rw-rw-r-- 1 50302564 May  4 13:35 raw.psl
 
     #	And, for the randoms
     mkdir /hive/data/outside/ncbi/sts.2009-04/primerAlign/runRandoms
     cd /hive/data/outside/ncbi/sts.2009-04/primerAlign/runRandoms
     
     partitionSequence.pl 40000000 20000 /scratch/data/hg19/hg19.2bit \
 	/scratch/data/hg19/chrom.sizes 100 -lstDir tParts \
 	| egrep "tParts|random|_hap|chrUn" \
 	| sed -e "s/.*2bit://;" > hg19.list
     cat tParts/* | sed -e "s/.*2bit://;" > hg19.list
     cat tParts/* > hg19.list
 
     cat > runOne.csh << '_EOF_'
 #!/bin/csh -fe
 
 set partSpec = $1
 set primer = ../split/$2
 set result = $3
 set tmpFile = "/scratch/tmp/$1.$2"
 /bin/mkdir -p psl/$partSpec
 /bin/rm -f $tmpFile.psl
 /cluster/bin/x86_64/isPcr -out=psl -minPerfect=2 -maxSize=5000 -tileSize=10 \
     -ooc=/hive/data/outside/ncbi/sts.2009-04/primerAlign/10.ooc -stepSize=5 \
 	/scratch/data/hg19/hg19.2bit:$partSpec $primer $tmpFile.psl
 /bin/rm -f $result
 mv $tmpFile.psl $result
 '_EOF_'
     # << happy emacs
     chmod +x runOne.csh
 
     #	can not use line+ check here, many of them are empty
     cat > template << '_EOF_'
 #LOOP
 runOne.csh $(file1) $(root2) {check out line psl/$(file1)/$(root2).psl}
 #ENDLOOP
 '_EOF_'
     # << happy emacs
 
     gensub2 hg19.list ../primer.list template jobList
     #	they run quickly, limit to 100
     para -maxJob=100 create jobList
     para try ... check ... push ... etc
 # Completed: 4416 of 4416 jobs
 # CPU time in finished jobs:       1746s      29.09m     0.48h    0.02d  0.000 y
 # IO & Wait Time:                 11407s     190.12m     3.17h    0.13d  0.000 y
 # Average job time:                   3s       0.05m     0.00h    0.00d
 # Longest finished job:               8s       0.13m     0.00h    0.00d
 # Submission to last job:           147s       2.45m     0.04h    0.00d
 
     #	sort and filter the results
     cd psl
     pslSort dirs raw.psl temp chr*
     #	4416 files in 69 dirs
     #	Got 4416 files 66 files per mid file
     rmdir temp
     #	-rw-rw-r-- 1 9066053 May  4 13:31 raw.psl
 
     #	putting the two runs together
     mkdir /hive/data/outside/ncbi/sts.2009-04/primerAlign/psl
     cd /hive/data/outside/ncbi/sts.2009-04/primerAlign/psl
     ln -s ../run/filter/raw.psl run.psl
     ln -s ../runRandoms/filter/raw.psl runRandoms.psl
     #	-rw-rw-r-- 1 50302564 May  4 13:35 run.psl
     #	-rw-rw-r-- 1   825973 May  4 13:35 runRandoms.psl
     cd ..
     pslSort dirs primers.psl temp psl
     #	2 files in 1 dirs
     #	Got 2 files 1 files per mid file
     #	-rw-rw-r-- 1 51128110 May  4 13:39 primers.psl
     wc -l primers.psl
     #	448107 primers.psl
     rmdir temp
     pslFilterPrimers primers.psl ../all.primers primers.filter.psl
     # creates primers.filter.unlifted.psl.notfound.primers
     wc -l primers*
     #	237962 primers.filter.psl
     #	97191 primers.filter.psl.notfound.primers
 
     #	see if ePCR can find some of these notfound
     ssh swarm
     mkdir /hive/data/outside/ncbi/sts.2009-04/primerAlign/epcr
     cd /hive/data/outside/ncbi/sts.2009-04/primerAlign/epcr
 
     mkdir split
     cd split
     split -l 5000 ../../primers.filter.psl.notfound.primers  primers_
     cd ..
     ls -1S split > primers.lst
     partitionSequence.pl 40000000 20000 /scratch/data/hg19/hg19.2bit \
 	/scratch/data/hg19/chrom.sizes 100 -lstDir tParts \
 	| grep -v tParts | sed -e "s/.*2bit://;" > hg19.list
     cat tParts/* | sed -e "s/.*2bit://;" >> hg19.list
 
     cat > runOne.csh << '_EOF_'
 #!/bin/csh -fe
 
 set partSpec = $1
 set primer = split/$2
 set result = $3
 set tmpFile = "/scratch/tmp/$1.$2"
 set start = `echo $partSpec | sed -e "s/.*://; s/-/ /" | awk '{print $1}'`
 set end = `echo $partSpec | sed -e "s/.*://; s/-/ /" | awk '{print $2}'`
 set range = `echo $start $end | awk '{print $2-$1}'`
 set chr = `echo $partSpec | sed -e "s/:.*//"`
 set chrSize = `grep -P "^$chr\t" /scratch/data/hg19/chrom.sizes | cut -f2`
 /bin/echo -e "$start\t$partSpec\t$range\t$chr\t$chrSize" > $tmpFile.lift
 /bin/mkdir -p epcr/$partSpec
 /bin/rm -f $tmpFile.psl
 twoBitToFa /scratch/data/hg19/hg19.2bit:$partSpec $tmpFile.fa
 /cluster/bin/scripts/runEpcr64 $primer $tmpFile.fa $tmpFile.epcr
 /bin/rm -f $result
 /bin/mv $tmpFile.epcr $result
 rm -f $tmpFile.fa $tmpFile.lift $tmpFile.psl $tmpFile.*
 '_EOF_'
     # << happy emacs
     chmod +x runOne.csh
 
     cat > template << '_EOF_'
 #LOOP
 runOne.csh $(file1) $(root2) {check out line epcr/$(file1)/$(root2).epcr}
 #ENDLOOP
 '_EOF_'
     # << happy emacs
 
     gensub2 hg19.list primers.lst template jobList
     para create jobList
 	# 3160 jobs
     para try ... check ... push ... etc ...
 # Completed: 3160 of 3160 jobs
 # CPU time in finished jobs:      86253s    1437.54m    23.96h    1.00d  0.003 y
 # IO & Wait Time:                 11196s     186.61m     3.11h    0.13d  0.000 y
 # Average job time:                  31s       0.51m     0.01h    0.00d
 # Longest finished job:              89s       1.48m     0.02h    0.00d
 # Submission to last job:           237s       3.95m     0.07h    0.00d
 
     find ./epcr -type f | xargs cat > all.epcr
     wc -l all.epcr
     #	797286 all.epcr
     # convert the coordinates from the partitionSequence.pl to a lift file
     awk '{print $1}' all.epcr | sort -u > hg19.partSpec.txt
     $HOME/kent/src/hg/stsMarkers/liftFromSpec.pl hg19 hg19.partSpec.txt \
 	> all.epcr.lift
     cat all.epcr | sed -e "s/\.\./ /; s/  */\t/g" \
 	| liftUp -type=.bed stdout all.epcr.lift error stdin \
 	| awk '
 {
 printf "%s %d..%d %d %d\n", $1, $2, $3, $4, $5
 }
 ' > all.epcr.lifted
 
     pslFilterPrimers -epcr=all.epcr.lifted -verbose=1 ../primers.psl \
     /cluster/home/hiram/bin/x86_64/pslFilterPrimers -epcr=all.epcr.lifted \
 	-verbose=1 ../primers.psl ../../all.primers epcr.primers.psl
     #	this took a long time, many hours
 # -rw-rw-r--   1  2785254 May  5 17:28 epcr.not.found
 # -rw-rw-r--   1 27343510 May  5 17:28 epcr.primers.psl
 # -rw-rw-r--   1  1616885 May  5 17:28 epcr.primers.psl.notfound.primers
 
     time ./epcrToHgPsl.pl epcr.not.found ../../all.primers \
     time $HOME/kent/src/hg/stsMarkers/epcrToPsl epcr.not.found \
 	../../all.primers /hive/data/genomes/hg19
     #	real    69m38.444s
     #	-rw-rw-r--   1        0 May  6 14:18 epcr.not.found.nomatch
     #	-rw-rw-r--   1  8369138 May  6 15:26 epcr.not.found.psl
 
     #	combining everything together now
     cd /hive/data/outside/ncbi/sts.2009-04/primerAlign
 
     sort -u primers.filter.psl epcr/epcr.primers.psl epcr/epcr.not.found.psl \
                 | sort -k15,15 -k17,17n > primers.final.psl
     wc -l primers.final.psl
     #	310705 primers.final.psl
 
     time $HOME/kent/src/hg/stsMarkers/fixPrimersQueryGaps.pl \
         ../all.primers primers.final.psl > primers.final.fix.psl
     #	real    0m19.580s
     wc -l primers.final.fix.psl
     #	310705 primers.final.fix.psl
 
     # Extract relevant info, make alignments unique, and create final file to
     #	be merged with full sequence alignments
     $HOME/kent/src/hg/stsMarkers/extractPslInfo -h primers.final.fix.psl
     #	real    0m15.303s
     #	-rw-rw-r-- 1 15660447 May  6 15:44 primers.final.fix.psl.initial
     wc -l primers.final.fix.psl.initial
     #	308210 primers.final.fix.psl.initial
     $HOME/kent/src/hg/stsMarkers/findAccession.pl -agp \
 	primers.final.fix.psl.initial /hive/data/genomes/hg19
     wc -l primers.final.fix.psl.initial.acc
     #	308210 primers.final.fix.psl.initial.acc
 
     $HOME/kent/src/hg/stsMarkers/getStsId ../stsInfo2.bed \
 	primers.final.fix.psl.initial.acc | sort -k 4n > primers.final
     wc -l primers.final
     # 308210 primers.final
     #	There doesn't appear to be any use for this primers.ids list
     #	except for curiosity.  Check the head and tail of this list to
     #	verify no garbage is in here.  There should just be numbers.
     awk '{print $4}' primers.final | sort -n | uniq > primers.ids
     wc -l primers.ids
     #	290961 primers.ids
 
     # Merge primer and sequence files to create final bed file
     # Merge (combineSeqPrimerPos) takes about an hour to run
     cd /hive/data/genomes/hg19/bed/sts
     time $HOME/kent/src/hg/stsMarkers/combineSeqPrimerPos stsMarkers.final \
 	/hive/data/outside/ncbi/sts.2009-04/primerAlign/primers.final
     #	real    0m12.310s
     #	-rw-rw-r-- 1 15222346 May  6 15:55 stsMarkers_pos.rdb
     wc -l stsMarkers_pos.rdb
     #	315308 stsMarkers_pos.rdb
 
     time /cluster/bin/scripts/createSTSbed \
 	/hive/data/outside/ncbi/sts.2009-04/stsInfo2.bed  \
 	stsMarkers_pos.rdb > stsMap.bed
     #	real    0m31.886s
     #	-rw-rw-r-- 1 38244880 May  6 16:25 stsMap.bed
     wc -l stsMap.bed
     #	305914 stsMap.bed
 
     # Set up sequence files
     ssh hgwdev
     mkdir /gbdb/hg19/sts.11/
     ln -s /hive/data/outside/ncbi/sts.11/all.STS.fa \
 	/gbdb/hg19/sts.11/all.STS.fa
     ln -s /hive/data/outside/ncbi/sts.11/all.primers.fa \
         /gbdb/hg19/sts.11/all.primers.fa
 
     # Load all files
     cd /hive/data/genomes/hg19/bed/sts
     hgLoadSeq hg19 /gbdb/hg19/sts.11/all.STS.fa /gbdb/hg19/sts.11/all.primers.fa
     #	Creating seq.tab file
     #	Adding /gbdb/hg19/sts.11/all.STS.fa
     #	100520 sequences
     #	Adding /gbdb/hg19/sts.11/all.primers.fa
     #	317592 sequences
     #	Updating seq table
     #	Advisory lock has been released
     #	All done
 
 
     hgsql hg19 < $HOME/kent/src/hg/lib/stsInfo2.sql
     hgsql hg19 < $HOME/kent/src/hg/lib/stsAlias.sql
     #	these files already exist here from previous operations
     # cp -p /hive/data/outside/ncbi/sts.11/{stsInfo2.bed,stsAlias.bed} .
     hgsql hg19 -e 'load data local infile "stsInfo2.bed" into table stsInfo2'
     hgsql hg19 -e 'load data local infile "stsAlias.bed" into table stsAlias'
     #	a couple minutes for each load above
     #	filter the stsMap.bed to eliminate items longer than 5,000 bases,
     #	takes out about 850:
     awk '$3-$2 < 5001' stsMap.bed | sort -k1,1 -k2,2n \
 	> stsMap.filtered.5000.bed
 
     hgLoadBed -notItemRgb -noBin -tab \
 	-sqlTable=$HOME/kent/src/hg/lib/stsMap.sql hg19 stsMap \
 	    stsMap.filtered.5000.bed
     #	Loaded 305064 elements of size 28
 
     ln -s \
 /hive/data/outside/ncbi/sts.2009-04/primerAlign/primers.final.fix.psl \
 	primers.psl
 
     hgLoadPsl -nobin -table=all_sts_primer hg19 primers.psl
     hgLoadPsl -nobin -table=all_sts_seq hg19 stsMarkers.psl
 
 ##############################################################################
 # FISH CLONES (WORKING - 2009-04-29 - Hiram)
 # The STS Marker and BAC End Pairs tracks must be completed prior to
 # creating this track.  
 
     mkdir /hive/data/outside/ncbi/fishClones/fishClones.2009-04/
     cd /hive/data/outside/ncbi/fishClones/fishClones.2009-04/
 
 # Download information from NCBI
         # point browser at:
 #   http://www.ncbi.nlm.nih.gov/genome/cyto/cytobac.cgi?CHR=all&VERBOSE=ctg
 # change "Sequence tag:" to "placed on contig"
         # change "Show details on sequence-tag" to "yes"
         # change "Download or Display" to "Download table for UNIX"
         # press Submit - save as
 # /hive/data/outside/ncbi/fishClones/fishClones.2009-04/hbrc.txt
     chmod 664 /hive/data/outside/ncbi/fishClones/fishClones.2009-04/hbrc.txt
 
 #	Unfortunately the format of this hbrc file has changed since
 #	last time.  The columns have been rearranged, and one important
 #	column is missing, the contig information.  So, let's see if we
 #	can recover the original format by putting this together with
 #	some other things we have here.
     $HOME/kent/src/hg/fishClones/fixup.hbrc.pl hbrc.txt \
 	/hive/data/genomes/hg19/bed/fishClones/seq_clone.pmd > fixed.hbrc.txt \
 	    2> dbg
     #	the seq_clone.pmd file was obtained via email from Wonhee Jang
     #	jang at ncbi.nlm.nih.gov - I have asked for clarification where
     #	such a file can be fetched without resorting to email.
 
 # Get current clone/accession information
     wget --timestamping http://www.ncbi.nlm.nih.gov/genome/clone/DATA/clac.out
 
 # Create initial Fish Clones bed file
     ssh kkstore02
     mkdir /hive/data/genomes/hg19/bed/fishClones
     cd /hive/data/genomes/hg19/bed/fishClones
 
     # Copy previous sts info from fhcrc
     cp -p /hive/data/genomes/hg18/bed/fishClones/fhcrc.sts .
     #	This fhcrc.sts listing doesn't change.  It is merely a listing
     #	of aliases that remain in effect.
 
     #	Create cl_acc_gi_len file form cloneend information:
     grep -v "^#" /hive/data/genomes/hg19/bed/cloneend/all.txt \
     | awk '{gsub(".[0-9]*$", "", $2);
 	printf "%s\t%s\t%s\t%s\t%s\t%s\n", $1,$2,$3,$4,$5,$8}' > cl_acc_gi_len
 
     hgsql -N \
 	-e "select chrom,chromStart,chromEnd,contig from ctgPos;" hg19 \
 	| sort -k1,1 -k2,2n > ctgPos.bed
     hgsql -N \
 -e "select chrom,chromStart,chromEnd,frag,0,strand from gold;" hg19 \
 	| sort -k1,1 -k2,2n > gold.bed
     hgsql -N \
 -e "select tName,tStart,tEnd,qName,0,strand from all_bacends;" hg19 \
 	| sort -k1,1 -k2,2n > all_bacends.bed
     hgsql -N \
 -e "select chrom,chromStart,chromEnd,name,score,strand from bacEndPairs;" hg19 \
 	| sort -k1,1 -k2,2n > bacEndPairs.bed
 
 
 
     ssh hgwdev
     #	have to be on hgwdev for this since it is going to read from the
     #	database.  Had to work on this program to get it past what is
     #	evidently a bad entry in hbrc.fixed where columns of information
     #	are missing for one clone in particular
     time fishClones -verbose=2 -fhcrc=fhcrc.sts -noBin hg19 \
 	/hive/data/outside/ncbi/fishClones/fishClones.2009-04/fixed.hbrc.txt \
 	/hive/data/outside/ncbi/fishClones/fishClones.2009-04/clac.out \
          ./cl_acc_gi_len \
          /hive/data/genomes/hg19/bed/bacends/bacEnds.lifted.psl \
             fishClones
     #	real    2m4.708s
 # Reading Fish Clones file /hive/data/genomes/ncbi/fishClones/fishClones.2006-01/hbrc.fixed
 # reading fishInfo file /hive/data/genomes/ncbi/fishClones/fishClones.2006-01/fixed.hbrc.txt
 # Reading Clone/Acc (clac.out) file /hive/data/genomes/ncbi/fishClones/fishClones.2006-01/clac.out
 # Reading BAC Ends file ./cl_acc_gi_len
 # Reading BAC Ends psl file /hive/data/genomes/hg19/bed/bacends/bacEnds.lifted.psl
 # Reading additional STS Marker links fhcrc.sts
 # Determining good positions
 #	findClonePos: determining positions of fish clones
 # Writing output file
 # ERROR: at line # 170, no cytoband info for chrX:104048913-104206974
 # RP11-79L11
 # ERROR: at line # 171, no cytoband info for chrX:104048913-104206974
 # RP11-79L11
 
     # Load the track
     ssh hgwdev
     cd /hive/data/genomes/hg19/bed/fishClones
     hgLoadBed -notItemRgb -noBin -tab \
         -sqlTable=$HOME/kent/src/hg/lib/fishClones.sql \
 	hg19 fishClones fishClones.bed
     #	Loaded 9461 elements of size 16
 
 ##############################################################################
 # UCSC to Ensembl chr name mapping (DONE - 2009-05-08 - Hiram)
     mkdir /hive/data/genomes/hg19/ensembl
     cd /hive/data/genomes/hg19/ensembl
     wget --timestamping \
 	'ftp://ftp.ensembl.org/pub/pre/homo_sapiens/GRCh37/dna/*'
     #	do not need the repeat masker sequence (although it would be
     #	interesting to measure to see how it compares)
     rm -f *.dna_rm.*
     #	fortunately we have the same sizes as Ensembl for everything
     #	(except the haplotypes) and the sizes are unique for each sequence
     #	so we can relate the names via their sizes
     mkdir /hive/data/genomes/hg19/bed/ucscToEnsembl
     cd /hive/data/genomes/hg19/bed/ucscToEnsembl
     #	the toplevel file is a duplicate of everything else
     ls /hive/data/genomes/hg19/ensembl/*.fa.gz | grep -v toplevel \
 	| while read F
 do
     zcat "${F}"
 done | faCount stdin > faCount.txt
 
     cat << '_EOF_' > relateUcscEnsembl.pl
 #!/usr/bin/env perl
 
 use strict;
 use warnings;
 
 my %ucscChrs;   # key is size, value is UCSC chr name
 
 open (FH,"<../../chrom.sizes") or die "can not read ../../chrom.sizes";
 while (my $line = <FH>) {
     chomp $line;
     my ($chr, $size) = split('\s+', $line);
     die "'$line\n'duplicate size in ../chrom.sizes" if (exists($ucscChrs{$size})
 );
     $ucscChrs{$size} = $chr;
 }
 close (FH);
 
 my %ensemblChrs;        # key is size, value is Ensembl chr name
 
 open (FH,"<faCount.txt") or die "can not read faCount.txt";
 while (my $line = <FH>) {
     next if ($line =~ m/#/);
     next if ($line =~ m/total/);
     chomp $line;
     my ($chr, $size, $rest) = split('\s+', $line, 3);
     die "'$line\n'duplicate size in faCount.txt" if (exists($ensemblChrs{$size})
 );
     $ensemblChrs{$size} = $chr;
 }
 close (FH);
 
 my %usedUcscChrs;
 my %usedEnsemblChrs;
 my %ensemblTranslate; # key is Ensembl name, value is UCSC size
 foreach my $size (keys %ucscChrs) {
     if (exists($ensemblChrs{$size})) {
         $usedUcscChrs{$size} = $ucscChrs{$size};
         $usedEnsemblChrs{$size} = $ensemblChrs{$size};
         printf "%s\t%s\t%d\n", $ucscChrs{$size}, $ensemblChrs{$size}, $size;
     } else {
         my $ucscName = $ucscChrs{$size};
         my $ensemblName = "unknown";
         if ($ucscName =~ m/^chr6/) {
             $ucscName =~ s/_hap.//;
             $ucscName =~ s/chr6_/chr6_mhc_/;
             $ensemblName = "HS" . uc($ucscName);
         } elsif ($ucscName =~ m/^chr17_/ || $ucscName =~ m/^chr4_/) {
             $ucscName =~ s/_.*/_1/;
             $ensemblName = "HS" . uc($ucscName);
         } elsif ($ucscName =~ m/^chrM/) {
             print "# no translation for chrM\n";
         } else {
             die "unknown UCSC chr name: $ucscName";
         }
         printf "# ucsc $ucscChrs{$size} -> $ensemblName\n";
         $ensemblTranslate{$ensemblName} = $size;
     }
 }
 
 foreach my $size (keys %ensemblChrs) {
     if (!exists($usedEnsemblChrs{$size})) {
         my $ensemblName = $ensemblChrs{$size};
         if (! exists($ensemblTranslate{$ensemblName})) {
             die "can not translate Ensembl name $ensemblName";
         } else {
             my $ucscSize = $ensemblTranslate{$ensemblName};
             printf "%s\t%s\t%d\t%d\n", $ucscChrs{$ucscSize}, $ensemblChrs{$size}
 , $ucscSize, $size;
         }
     }
 }
 
 printf "chrM\tMT\n";
 '_EOF_'
     # << happy emacs
     chmod +x relateUcscEnsembl.pl
 
     ./relateUcscEnsembl.pl  2>&1 | grep -v "^#" \
 	| awk '{printf "%s\t%s\n", $1, $2}' | sort > ucscToEnsembl.tab
 
     cat << '_EOF_' > ucscToEnsembl.sql
 # UCSC to Ensembl chr name translation
 CREATE TABLE ucscToEnsembl (
     ucsc varchar(255) not null,        # UCSC chromosome name
     ensembl varchar(255) not null,     # Ensembl chromosome name
               #Indices
     PRIMARY KEY(ucsc(21))
 );
 '_EOF_'
 
     hgsql hg19 < ucscToEnsembl.sql
     hgsql hg19 \
 -e 'LOAD DATA LOCAL INFILE "ucscToEnsembl.tab" INTO TABLE ucscToEnsembl'
 
     awk '{printf "%s\t%d\n", $2, -$1}' ../../jkStuff/ensGene.haplotype.lift \
 	> ensemblLift.tab
 
     cat << '_EOF_' > ensemblLift.sql
 # UCSC offset to Ensembl coordinates
 CREATE TABLE ensemblLift (
     chrom varchar(255) not null,      # Ensembl chromosome name
     offset int unsigned not null,     # offset to add to UCSC position 
               #Indices
     PRIMARY KEY(chrom(15))
 );
 '_EOF_'
 
     hgsql hg19 < ensemblLift.sql
     hgsql hg19 \
 -e 'LOAD DATA LOCAL INFILE "ensemblLift.tab" INTO TABLE ensemblLift'
+
 ##############################################################################
+# BLASTZ MOUSE Mm9 (DONE - 2009-05-11 - Hiram)
+    mkdir /hive/data/genomes/hg19/bed/lastzMm9.2009-05-11
+    cd /hive/data/genomes/hg19/bed/lastzMm9.2009-05-11
+
+    cat << '_EOF_' > DEF
+# human vs mouse
+BLASTZ_ABRIDGE_REPEATS=1
+
+# TARGET: Human Hg19
+SEQ1_DIR=/scratch/data/hg19/nib
+SEQ1_SMSK=/scratch/data/hg19/linSpecRep/lineageSpecificRepeats
+SEQ1_LEN=/scratch/data/hg19/chrom.sizes
+SEQ1_CHUNK=10000000
+SEQ1_LAP=0
+
+# QUERY: Mouse Mm9
+SEQ2_DIR=/scratch/data/mm9/nib
+SEQ2_SMSK=/scratch/data/mm9/notInOthers
+SEQ2_LEN=/scratch/data/mm9/chrom.sizes
+SEQ2_CHUNK=10000000
+SEQ2_LAP=10000
+    
+BASE=/hive/data/genomes/hg19/bed/lastzMm9.2009-05-11
+TMPDIR=/scratch/tmp
+'_EOF_'
+    # << happy emacs
+
+    #	establish a screen to control this job
+    screen
+    time nice -n +19 doBlastzChainNet.pl -verbose=2 \
+	`pwd`/DEF \
+	-workhorse=hgwdev -smallClusterHub=memk -bigClusterHub=swarm \
+	-chainMinScore=3000 -chainLinearGap=medium > do.log 2>&1 &
+XXX - running Mon May 11 13:40:46 PDT 2009
+
+#########################################################################
+# BLASTZ Dog CanFam2 (DONE - 2009-05-11 - Hiram)
+    mkdir /hive/data/genomes/hg19/bed/lastzCanFam2.2009-05-11
+    cd /hive/data/genomes/hg19/bed/lastzCanFam2.2009-05-11
+
+    cat << '_EOF_' > DEF
+# human vs dog
+BLASTZ_ABRIDGE_REPEATS=1
+
+# TARGET: Human Hg19
+SEQ1_DIR=/scratch/data/hg19/nib
+SEQ1_SMSK=/scratch/data/hg19/linSpecRep/lineageSpecificRepeats
+SEQ1_LEN=/scratch/data/hg19/chrom.sizes
+SEQ1_CHUNK=10000000
+SEQ1_LAP=0
+
+# QUERY: Dog CanFam2
+SEQ2_DIR=/scratch/data/canFam2/nib
+SEQ2_LEN=/scratch/data/canFam2/chrom.sizes
+SEQ2_SMSK=/scratch/scratch/data/canFam2/linSpecRep.notInHuman
+SEQ2_IN_CONTIGS=0
+SEQ2_CHUNK=20000000
+SEQ2_LAP=10000
+
+BASE=/hive/data/genomes/hg19/bed/lastzCanFam2.2009-05-11
+TMPDIR=/scratch/tmp
+'_EOF_'
+    # << happy emacs
+
+    #	establish a screen to control this job
+    screen
+    time nice -n +19 doBlastzChainNet.pl -verbose=2 \
+	`pwd`/DEF \
+	-workhorse=hgwdev -smallClusterHub=memk -bigClusterHub=swarm \
+	-chainMinScore=3000 -chainLinearGap=medium > do.log 2>&1 &
+XXX - running Mon May 11 13:40:46 PDT 2009
+
+#########################################################################