src/hg/encode/validateFiles/validateFiles.c 1.29

1.29 2009/11/10 21:52:08 tdreszer
validateFiles.c
Index: src/hg/encode/validateFiles/validateFiles.c
===================================================================
RCS file: /projects/compbio/cvsroot/kent/src/hg/encode/validateFiles/validateFiles.c,v
retrieving revision 1.28
retrieving revision 1.29
diff -b -B -U 1000000 -r1.28 -r1.29
--- src/hg/encode/validateFiles/validateFiles.c	30 Sep 2009 21:40:00 -0000	1.28
+++ src/hg/encode/validateFiles/validateFiles.c	10 Nov 2009 21:52:08 -0000	1.29
@@ -1,1123 +1,1124 @@
 #include "common.h"
 #include "linefile.h"
 #include "hash.h"
 #include "options.h"
 #include "chromInfo.h"
 #include "jksql.h"
 #include "twoBit.h"
 #include "dnaseq.h"
 
 static char const rcsid[] = "$Id$";
 static char *version = "$Revision$";
 
 #define MAX_ERRORS 10
 #define PEAK_WORDS 16
 #define TAG_WORDS 9
 #define QUICK_DEFAULT 1000
 
 enum bedType {BED_GRAPH = 0, BROAD_PEAK, NARROW_PEAK, GAPPED_PEAK};
 
 int maxErrors;
 boolean colorSpace;
 boolean zeroSizeOk;
 boolean chrMSizeOk;
 boolean printOkLines;
 boolean printFailLines;
 boolean mmPerPair;
 boolean nMatch;
 boolean isSort;
 int quick;
 struct hash *chrHash = NULL;
 char dnaChars[256];
 char qualChars[256];
 char csQualChars[256];
 char seqName[256];
 char digits[256];
 char alpha[256];
 char csSeqName[256];
 char bedTypeCols[10];
 struct twoBitFile *genome = NULL;
 int mismatches;
 int matchFirst=0;
 int mmCheckOneInN;
 
 void usage()
 /* Explain usage and exit. */
 {
 errAbort(
   "validateFiles - Validate format of different track input files\n"
   "                Program exits with non-zero status if any errors detected\n"
   "                  otherwise exits with zero status\n"
   "                Use filename 'stdin' to read from stdin\n"
   "                Files can be in .gz, .bz2, .zip, .Z format and are \n"
   "                  automatically decompressed\n"
   "                Multiple input files of the same type can be listed\n"
   "                Error messages are written to stderr\n"
   "                OK or failing file lines can be optionally written to stdout\n"
   "usage:\n"
   "   validateFiles -type=FILE_TYPE file1 [file2 [...]]\n"
   "options:\n"
   "   -type=(a value from the list below)\n"
   "         tagAlign|pairedTagAlign|broadPeak|narrowPeak|gappedPeak|bedGraph\n"
   "                   : see http://genomewiki.cse.ucsc.edu/EncodeDCC/index.php/File_Formats\n"
   "         fasta     : Fasta files (only one line of sequence, and no quality scores)\n"
   "         fastq     : Fasta with quality scores (see http://maq.sourceforge.net/fastq.shtml)\n"
   "         csfasta   : Colorspace fasta (implies -colorSpace) (see link below)\n"
   "         csqual    : Colorspace quality (see link below)\n"
   "                     (see http://marketing.appliedbiosystems.com/mk/submit/SOLID_KNOWLEDGE_RD?_JS=T&rd=dm)\n"
   "\n"
   "   -chromDb=db                  Specify DB containing chromInfo table to validate chrom names\n"
   "                                  and sizes\n"
   "   -chromInfo=file.txt          Specify chromInfo file to validate chrom names and sizes\n"
   "   -colorSpace                  Sequences include colorspace values [0-3] (can be used \n"
   "                                  with formats such as tagAlign and pairedTagAlign)\n"
   "   -maxErrors=N                 Maximum lines with errors to report in one file before \n"
   "                                  stopping (default %d)\n"
   "   -zeroSizeOk                  For BED-type positional data, allow rows with start==end\n"
   "                                  otherwise require strictly start < end\n"
   "   -genome=path/to/hg18.2bit    Validate tagAlign or pairedTagAlign sequences match genome\n"
   "                                  in .2bit file\n"
   "   -mismatches=n                Maximum number of mismatches in sequence (or read pair) if \n"
   "                                  validating tagAlign or pairedTagAlign files\n"
   "   -matchFirst=n                only check the first N bases of the sequence\n"
   "   -mmPerPair                   Check either pair dont exceed mismatch count if validating\n"
   "                                  pairedTagAlign files (default is the total for the pair)\n"
   "   -mmCheckOneInN=n             Check mismatches in only one in 'n' lines (default=1, all)\n"
   "   -printOkLines                Print lines which pass validation to stdout\n"
   "   -quick[=N]                   Just test the first N lines of each file (default 1000)\n"
   "   -printFailLines              Print lines which fail validation to stdout\n"
   "   -isSort                      input is sorted by chrom\n"
+//"   -acceptDot                   Accept '.' as 'N' in DNA sequence\n"
   "   -nMatch                      N's do not count as a mismatch\n"
   "   -version                     Print version\n"
   , MAX_ERRORS);
 }
 
 static struct optionSpec options[] = {
    {"type", OPTION_STRING},
    {"chromDb", OPTION_STRING},
    {"chromInfo", OPTION_STRING},
    {"maxErrors", OPTION_INT},
    {"colorSpace", OPTION_BOOLEAN},
    {"zeroSizeOk", OPTION_BOOLEAN},
    {"chrMSizeOk", OPTION_BOOLEAN},
    {"printOkLines", OPTION_BOOLEAN},
    {"printFailLines", OPTION_BOOLEAN},
    {"genome", OPTION_STRING},
    {"mismatches", OPTION_INT},
    {"matchFirst", OPTION_INT},
    {"mmPerPair", OPTION_BOOLEAN},
    {"mmCheckOneInN", OPTION_INT},
    {"quick", OPTION_INT},
    {"nMatch", OPTION_BOOLEAN},
+// {"acceptDot", OPTION_BOOLEAN},
    {"isSort", OPTION_BOOLEAN},
    {"version", OPTION_BOOLEAN},
    {NULL, 0},
 };
 
 boolean checkMismatch(int ch1, int ch2)
 // checkMismatch -- if the sequence has an N, we call this a mismatch
 //   by default unless nMatch is set, in which case we don't call
 //   it a mismatch
 {
 if (ch1 != 'n')
     return ch1 != ch2;
 
 return !nMatch;
 }
 
 void initArrays()
 // Set up array of chars
 // dnaChars:  DNA chars ACGTNacgtn, and optionally include colorspace 0-3
 // qualChars: fastq quality scores as ascii [!-~] (ord(!)=33, ord(~)=126)
 // csQualChars: csfasta quality scores are decimals separated by spaces
 // seqName:   fastq sequence name chars [A-Za-z0-9_.:/-]
 {
 int i;
 // number of columns to expect in bedType files
 bedTypeCols[BED_GRAPH] = 4;
 bedTypeCols[BROAD_PEAK] = 9;
 bedTypeCols[NARROW_PEAK] = 10;
 bedTypeCols[GAPPED_PEAK] = 15;
 
 for (i=0 ; i < 256 ; ++i)
     dnaChars[i] = qualChars[i] = csQualChars[i] = seqName[i] = csSeqName[i] = digits[i] = alpha[i] = 0;
 dnaChars['a'] = dnaChars['c'] = dnaChars['g'] = dnaChars['t'] = dnaChars['n'] = 1;
 dnaChars['A'] = dnaChars['C'] = dnaChars['G'] = dnaChars['T'] = dnaChars['N'] = 1;
 if (colorSpace)
     {
     dnaChars['0'] = dnaChars['1'] = dnaChars['2'] = dnaChars['3'] = 1;
     }
 for (i= (int)'A' ; i <= (int)'Z' ; ++i)
     seqName[i] = seqName[i+(int)('a'-'A')] = alpha[i] = alpha[i+(int)('a'-'A')] = 1;
 for (i= (int)'0' ; i <= (int)'9' ; ++i)
     seqName[i] = digits[i] = csSeqName[i] = csQualChars[i] = 1;
 seqName['_'] = seqName['.'] = seqName[':'] = seqName['/'] = seqName['-'] = seqName['#'] = 1;
 csSeqName[','] = csSeqName['.'] = csSeqName['-'] = csSeqName['#'] = 1;
 csQualChars[' '] = 1;
 for (i= (int)'!' ; i <= (int)'~' ; ++i)
     qualChars[i] = 1;
 }
 
 struct hash *chromHash(struct chromInfo *ci)
 // Return a hash table of chrom name to chrom size
 {
 unsigned *size;
 struct hash *h = newHash(0);
 for ( ; ci ; ci = ci->next )
     {
     AllocVar(size);
     *size = ci->size;
     verbose(3,"[%s %3d] hashAdd(%s -> %p = %u)\n", __func__, __LINE__, ci->chrom, size, *size);
     hashAdd(h, ci->chrom, size);
     }
 return h;
 }
 
 boolean checkUnsigned(char *file, int line, char *row, char *s, unsigned *val, char *name)
 /* Convert series of digits to unsigned integer about
  * twice as fast as atoi (by not having to skip white
  * space or stop except at the null byte.)
  * Returns true if conversion possible, and value is returned in 'val'
  * Otherwise prints warning and returns false */
 {
 unsigned res = 0;
 char *p = s;
 char c;
 
 while (((c = *(p++)) >= '0') && (c <= '9'))
     {
     res *= 10;
     res += c - '0';
     }
 if (c != '\0')
     {
     warn("Error [file=%s, line=%d]: %s field invalid unsigned number (%s) [%s]", file, line, name, s, row);
     return FALSE;
     }
 *val = res;
 return TRUE;
 }
 
 boolean checkSigned(char *file, int line, char *row, char *s, int *val, char *name)
 /* Convert string to signed integer.  Unlike atol assumes
  * all of string is number.
  * Returns true if conversion possible, and value is returned in 'val'
  * Otherwise prints warning and returns false */
 {
 int res = 0;
 char *p, *p0 = s;
 
 if (*p0 == '-')
     p0++;
 p = p0;
 while ((*p >= '0') && (*p <= '9'))
     {
     res *= 10;
     res += *p - '0';
     p++;
     }
 /* test for invalid character, empty, or just a minus */
 if ((*p != '\0') || (p == p0))
     {
     warn("Error [file=%s, line=%d]: %s field invalid signed number (%s) [%s]", file, line, name, s, row);
     return FALSE;
     }
 if (*s == '-')
     *val = -res;
 else
     *val = res;
 return TRUE;
 }
 
 boolean checkString(char *file, int line, char *row, char *s, char *name)
 // Return TRUE if string has non-zero length
 // Othewise print warning that name column is empty and return FALSE
 {
 verbose(3,"[%s %3d] %s(%s)\n", __func__, __LINE__, name, s);
 if (strlen(s) > 0)
     return TRUE;
 warn("Error [file=%s, line=%d]: %s column empty [%s]", file, line, name, row);
 return FALSE;
 }
 
 boolean checkChrom(char *file, int line, char *row, char *s, unsigned *chromSize)
 // Return TRUE if string has non-zero length
 // Othewise print warning that name column is empty and return FALSE
 {
 unsigned *size;
 *chromSize = 0;
 if (strlen(s) > 0)
     {
     if (chrHash)
 	{
 	if ( (size = hashFindVal(chrHash, s)) != NULL)
 	    {
 	    *chromSize = *size;
 	    verbose(2,"[%s %3d] hashFindVal(%s -> %p = %u)\n", __func__, __LINE__, s, size, *size);
 	    return TRUE; // found chrom
 	    }
 	else
 	    {
 	    warn("Error [file=%s, line=%d]: chrom %s not found [%s]", file, line, s, row);
 	    return FALSE; // chrom not found
 	    }
 	}
     else
 	{
 	verbose(2,"[%s %3d] chrom(%s) \n", __func__, __LINE__, s);
 	return TRUE; // chrom name not blank, and not validating against chromInfo
 	}
     }
 warn("Error [file=%s, line=%d]: chrom column empty [%s]", file, line, row);
 return FALSE;
 }
 
 boolean checkSeq(char *file, int line, char *row, char *s, char *name)
 // Return TRUE if string has non-zero length and contains only chars [ACGTNacgtn0-3]
 // Othewise print warning that name column is empty and return FALSE
 {
 verbose(3,"[%s %3d] inputLine=%d %s seq(%s) [%s]\n", __func__, __LINE__, line, name, s, row);
 int i;
 for ( i = 0; s[i] ; ++i)
     {
     if (!dnaChars[(int)s[i]])
 	{
 	if (s==row)
 	    warn("Error [file=%s, line=%d]: invalid DNA chars in %s(%s)", file, line, name, s);
 	else
 	    warn("Error [file=%s, line=%d]: invalid DNA chars in %s(%s) [%s]", file, line, name, s, row);
 	return FALSE;
 	}
     }
 if (i == 0)
     {
     if (s==row)
 	warn("Error [file=%s, line=%d]: %s empty", file, line, name);
     else
 	warn("Error [file=%s, line=%d]: %s empty in line [%s]", file, line, name, row);
     return FALSE;
     }
 return TRUE;
 }
 
 boolean checkSeqName(char *file, int line, char *s, char firstChar, char *name)
 // Return TRUE if string has non-zero length and contains only seqName[] chars
 // Othewise print warning that seqName is empty and return FALSE
 {
 int i;
 if (s[0] == 0)
     {
     warn("Error [file=%s, line=%d]: %s empty [%s]", file, line, name, s);
     return FALSE;
     }
 else if (s[0] != firstChar)
     {
     warn("Error [file=%s, line=%d]: %s first char invalid (got '%c', wanted '%c') [%s]",
 	file, line, name, s[0], firstChar, s);
     return FALSE;
     }
 for ( i = 1; s[i] ; ++i)
     {
     if (!seqName[(int)s[i]])
 	{
 	warn("Error [file=%s, line=%d]: invalid %s chars in [%s]", file, line, name, s);
 	return FALSE;
 	}
     }
 return TRUE;
 }
 
 char *getDigits(char *s)
 // Consume 1 or more digits from s, return pointer to next non-digit
 // Return NULL if no digits consumed
 {
 char *s0 = s;
 while (digits[(int) *s])
     ++s;
 if (s > s0)
     return s;
 else
     return NULL;
 }
 
 boolean checkTrailingCsSeqName(char *s)
 // Return true if all chars in s (if any) are csSeqName chars
 // Return false otherwise
 {
 while (csSeqName[(int) *s])
     ++s;
 if (*s == 0)
     return TRUE;
 else
     return FALSE;
 }
 
 //     >461_19_209_F3
 //     T022213002230311203200200322000
 //     >920_22_656_F3,1.-152654094.1.35.35.0###,19.43558664.1.35.35.0###
 //     T01301010111200210102321210100112312
 
 boolean checkCsSeqName(char *file, int line, char *s)
 // Return TRUE if string has non-zero length, matches CS name pattern contains only csSeqName[] chars
 // Othewise print warning that seqName is empty and return FALSE
 {
 char *s0;
 if (s[0] == 0)
     {
     warn("Error [file=%s, line=%d]: sequence name empty [%s]", file, line, s);
     return FALSE;
     }
 else if (s[0] != '>')
     {
     warn("Error [file=%s, line=%d]: sequence name first char invalid (got '%c', wanted '>') [%s]",
 	file, line, s[0], s);
     return FALSE;
     }
 if ( (s0 = getDigits(s+1))
       && (*(s0++) == '_')
       && (s0 = getDigits(s0)) && (*(s0++) == '_')
       && (s0 = getDigits(s0)) && (*(s0++) == '_')
       && alpha[(int) *(s0++)] && digits[(int) *(s0++)]
       && checkTrailingCsSeqName(s0) )
     {
     verbose(2,"[%s %3d] OK [%s] file(%s) line=%d\n", __func__, __LINE__, s, file, line);
     return TRUE;
     }
 else
     {
     warn("Error [file=%s, line=%d]: invalid sequence name [%s]", file, line, s);
     return FALSE;
     }
 }
 
 boolean checkQual(char *file, int line, char *s)
 // Return TRUE if string has non-zero length and contains only qualChars[] chars
 // Othewise print warning that quality is empty and return FALSE
 {
 int i;
 for ( i = 0; s[i] ; ++i)
     {
     if (!qualChars[(int)s[i]])
 	{
 	warn("Error [file=%s, line=%d]: invalid quality chars in [%s]", file, line, s);
 	return FALSE;
 	}
     }
 if (i == 0)
     {
     warn("Error [file=%s, line=%d]: quality empty [%s]", file, line, s);
     return FALSE;
     }
 return TRUE;
 }
 
 boolean checkCsQual(char *file, int line, char *s)
 // Return TRUE if string has non-zero length and contains quality scores
 // Othewise print warning that quality is empty and return FALSE
 {
 int i;
 for ( i = 0; s[i] ; ++i)
     {
     if (!csQualChars[(int)s[i]])
 	{
 	warn("Error [file=%s, line=%d]: invalid colorspace quality chars in [%s]", file, line, s);
 	return FALSE;
 	}
     }
 if (i == 0)
     {
     warn("Error [file=%s, line=%d]: colorspace quality empty [%s]", file, line, s);
     return FALSE;
     }
 return TRUE;
 }
 
 boolean checkStartEnd(char *file, int line, char *row, char *start, char *end, char *chrom, unsigned chromSize, unsigned *sVal, unsigned *eVal)
 // Return TRUE if start and end are both >= 0,
 // and if zeroSizeOk then start <= end
 //        otherwise  then start < end
 // Also check end <= chromSize (as a special case, ignore chrM end if chrMSizeOk)
 // start and end values are returned in sVal and eVal
 // Othewise print warning and return FALSE
 {
 verbose(3,"[%s %3d] inputLine=%d [%s..%s] (chrom=%s,size=%u) [%s]\n", __func__, __LINE__, line, start, end, chrom, chromSize, row);
 unsigned s, e;
 if (   !checkUnsigned(file, line, row, start, &s, "chromStart")
     || !checkUnsigned(file, line, row, end, &e, "chromEnd"))
     return FALSE;
 *sVal = s;
 *eVal = e;
 if (chromSize > 0)
     {
     if (e > chromSize && !(chrMSizeOk && sameString(chrom, "chrM")))
 	{
 	warn("Error [file=%s, line=%d]: end(%u) > chromSize(%s=%u) [%s]", file, line, e, chrom, chromSize, row);
 	return FALSE;
 	}
     else
 	verbose(2,"[%s %3d] end <= chromSize (%u <= %u)\n", __func__, __LINE__, e, chromSize);
     }
 if (zeroSizeOk)
     {
     if (s <= e)
 	{
 	verbose(2,"[%s %3d] start <= end (%u <= %u)\n", __func__, __LINE__, s, e);
 	return TRUE;
 	}
     else
 	warn("Error [file=%s, line=%d]: start(%u) > end(%u) [%s]", file, line, s, e, row);
     }
 else
     {
     if (s < e)
 	{
 	verbose(2,"[%s %3d] start < end (%u < %u)\n", __func__, __LINE__, s, e);
 	return TRUE;
 	}
     else
 	warn("Error [file=%s, line=%d]: start(%u) >= end(%u) [%s]", file, line, s, e, row);
     }
 return FALSE;
 }
 
 boolean checkPeak(char *file, int line, char *row, char *peak, char *start, char *end)
 // Return TRUE if peak is >= 0 and <= (end-start)
 // Othewise print warning and return FALSE
 {
 verbose(3,"[%s %3d] inputLine=%d peak(%s) (%s,%s) [%s]\n", __func__, __LINE__, line, peak, start, end, row);
 unsigned p, s, e;
 if (   !checkUnsigned(file, line, row, peak, &p, "peak")
     || !checkUnsigned(file, line, row, start, &s, "chromStart")
     || !checkUnsigned(file, line, row, end, &e, "chromEnd"))
     return FALSE;
 if (p > e - s)
     {
     warn("Error [file=%s, line=%d]: peak(%u) past block length (%u) [%s]", file, line, p, e - s, row);
     return FALSE;
     }
 return TRUE;
 }
 
 boolean checkIntBetween(char *file, int line, char *row, char *val, char *name, int min, int max)
 // Return TRUE if val is integer between min and max
 // Othewise print warning and return FALSE
 {
 int i;
 if (!checkSigned(file, line, row, val, &i, name))
     return FALSE;
 verbose(2,"[%s %3d] inputLine=%d [%s] -> [%d] [%s,%d..%d]\n", __func__, __LINE__, line, val, i, name, min, max);
 if (i >= min && i <= max)
     {
     verbose(2,"[%s %3d] min <= value <= max (%d <= %d <= %d)\n", __func__, __LINE__, min, i, max);
     return TRUE;
     }
 warn("Error [file=%s, line=%d]: %s %d outside bounds (%d, %d) [%s]", file, line, name, i, min, max, row);
 return FALSE;
 }
 
 boolean checkFloat(char *file, int line, char *row, char *val, char *name)
 // Return TRUE if val is floating point number
 // Othewise print warning and return FALSE
 // taken from sqlNum.c
 {
 char* end;
 double discardMe = strtod(val, &end);
 if ((end == val) || (*end != '\0'))
     {
     warn("Error [file=%s, line=%d]: invalid %s '%s' [%s]", file, line, name, val, row);
     discardMe = 0.0;
     return FALSE;
     }
 return TRUE;
 }
 
 boolean checkStrand(char *file, int line, char *row, char *strand)
 // Return TRUE if strand == '+' or '-' or '.',
 // Othewise print warning and return FALSE
 {
 if (strlen(strand) == 1 && (*strand == '+' || *strand == '-' || *strand == '.'))
     {
     verbose(2,"[%s %3d] strand(%s)\n", __func__, __LINE__, strand);
     return TRUE;
     }
 warn("Error [file=%s, line=%d]: invalid strand '%s' (want '+','-','.') [%s]", file, line, strand, row);
 return FALSE;
 }
 
 boolean wantNewLine(struct lineFile *lf, char *file, int line, char **row, char *msg)
 {
 boolean res = lineFileNext(lf, row, NULL);
 if (!res)
     warn("Error [file=%s, line=%d]: %s not found", file, line, msg);
 return res;
 }
 
 boolean checkColumns(char *file, int line, char *row, char *buf, char *words[], int wordSize, int expected)
 // Split buf into wordSize columns in words[] array
 // Return TRUE if number of columns == expected, otherwise FALSE
 {
 int n = chopByWhite(buf, words, wordSize);
 if ( n != expected)
     {
     warn("Error [file=%s, line=%d]: found %d columns, expected %d [%s]", file, line, n, expected, row);
     return FALSE;
     }
 return TRUE;
 }
 
 boolean checkMismatchesSeq(char *file, int line, char *chrom, unsigned chromStart, unsigned chromEnd, char strand, char *seq)
 {
 int i, mm = 0;
 struct dnaSeq *g;
 static struct dnaSeq *cacheSeq = NULL;
 static char cacheChrom[1024];
 static char bigArr[100 * 1024]; // 100K limit on tagAlign seqLen
 struct dnaSeq ourSeq;
 
 if (!genome)
     return TRUE; // only check if 2bit file specified
 if (line % mmCheckOneInN != 0)
     return TRUE; // dont check if this is not one in N
 if (!isSort)
     {
     g = twoBitReadSeqFragLower(genome, chrom, chromStart, chromEnd);
     }
 else
     {
     // read the whole chrom
     if ((cacheChrom == NULL) || !sameString(chrom, cacheChrom))
 	{
 	freeDnaSeq(&cacheSeq);
 	int size =  twoBitSeqSize(genome, chrom);
 	cacheSeq = twoBitReadSeqFragLower(genome, chrom, 0, size);
 	strcpy(cacheChrom, chrom);
 	verbose(2, "read in chrom %s size %d\n",cacheChrom, size);
 	}
     int len = chromEnd - chromStart;
     if (len > sizeof(bigArr))
 	errAbort("static array not big enough for sequence len %d on line %d\n",
 	    len, line);
     g = &ourSeq;
     g->dna = bigArr;
     g->size = len;
     memcpy(g->dna, &cacheSeq->dna[chromStart], len);
     }
 
 if (strand == '-')
     reverseComplement(g->dna, g->size);
 
 if (g->size != strlen(seq) || g->size != chromEnd-chromStart)
     {
     warn("Error [file=%s, line=%d]: sequence (%s) length (%d) does not match genomic coords (%d / %d - %s %d %d)", 
          file, line, seq, (int)strlen(seq), chromEnd-chromStart, g->size,
 	 chrom, chromStart, chromEnd);
     return FALSE;
     }
 
 int length = g->size;
 if (matchFirst && (matchFirst < length))
     length = matchFirst;
 
 for (i=0 ; i < length; ++i)
     {
     char c = tolower(seq[i]);
     if (checkMismatch(c,  g->dna[i]))
         ++mm;
     }
 if (mm > mismatches)
     {
     warn("Error [file=%s, line=%d]: too many mismatches (found %d/%d, maximum is %d) (%s %d %d %c)\nseq=[%s]\ngen=[%s]\n", 
          file, line, mm, g->size, mismatches, chrom, chromStart, chromEnd, strand, seq, g->dna);
     return FALSE;
     }
 if (!isSort)
     freeDnaSeq(&g);
 return TRUE;
 }
 
 boolean checkMismatchesSeq1Seq2(char *file, int line, char *chrom, unsigned chromStart, unsigned chromEnd, char strand, char *seq1, char *seq2)
 {
 int i, mm1, mm2, len1, len2;
 struct dnaSeq *g1, *g2;
 if (!genome)
     return TRUE; // dont check unless 2bit file specified
 if (line % mmCheckOneInN != 0)
     return TRUE; // dont check if this is not one in N
 len1 = strlen(seq1);
 len2 = strlen(seq2);
 if (strand == '-')
     {
     g1 = twoBitReadSeqFragLower(genome, chrom, chromEnd-len1, chromEnd);
     g2 = twoBitReadSeqFragLower(genome, chrom, chromStart, chromStart+len2);
     reverseComplement(g1->dna, g1->size);
     reverseComplement(g2->dna, g2->size);
     }
 else
     {
     g1 = twoBitReadSeqFragLower(genome, chrom, chromStart, chromStart+len1);
     g2 = twoBitReadSeqFragLower(genome, chrom, chromEnd-len2, chromEnd);
     }
 if (g1->size != len1 || g2->size != len2)
     {
     warn("Error [file=%s, line=%d]: sequence lengths (%d, %d) do not match genomic ones (%d, %d)", 
          file, line, len1, len2, g1->size, g2->size);
     return FALSE;
     }
 mm1 = 0;
 for (i=0 ; i < g1->size ; ++i)
     {
     char c = tolower(seq1[i]);
     if (checkMismatch(c,  g1->dna[i]))
         ++mm1;
     }
 mm2 = 0;
 for (i=0 ; i < g2->size ; ++i)
     {
     char c = tolower(seq2[i]);
     if (checkMismatch(c,  g2->dna[i]))
         ++mm2;
     }
 if (mmPerPair)
     {
     if (mm1 > mismatches || mm2 > mismatches)
         {
         warn("Error [file=%s, line=%d]: too many mismatches in one or both (seq1=%d/%d, seq2=%d/%d, maximum is %d) (%s %d %d %c)\nseq1=[%s] seq2=[%s]\ngen1=[%s] gen2=[%s]\n", 
              file, line, mm1, len1, mm2, len2, mismatches, chrom, chromStart, chromEnd, strand, seq1, seq2, g1->dna, g2->dna);
         return FALSE;
         }
     }
 else
     {
     if (mm1+mm2 > mismatches)
         {
         warn("Error [file=%s, line=%d]: too many mismatches in pair (seq1=%d/%d, seq2=%d/%d, maximum is %d) (%s %d %d %c)\nseq1=[%s] seq2=[%s]\ngen1=[%s] gen2=[%s]\n", 
              file, line, mm1, len1, mm2, len2, mismatches, chrom, chromStart, chromEnd, strand, seq1, seq2, g1->dna, g2->dna);
         return FALSE;
         }
     }
 freeDnaSeq(&g1);
 freeDnaSeq(&g2);
 return TRUE;
 }
 
 int validateTagOrPairedTagAlign(struct lineFile *lf, char *file, boolean paired)
 {
 char *row;
 char buf[1024];
 char *words[TAG_WORDS];
 int line = 0;
 int errs = 0;
 unsigned chromSize;
 int size;
-// Dot in place of N for tagaligns from Larry's group. Maybe remove this later.
-int savedot = dnaChars[(int)'.'];
-dnaChars[(int)'.'] = 1;
 verbose(2,"[%s %3d] paired=%d file(%s)\n", __func__, __LINE__, paired, file);
 while (lineFileNext(lf, &row, &size))
     {
     unsigned start, end;
     ++line;
     if (quick && line > quick)
 	break;
     safecpy(buf, sizeof(buf), row);
     if ( checkColumns(file, line, row, buf, words, TAG_WORDS, (paired ? 8 : 6))
 	&& checkChrom(file, line, row, words[0], &chromSize)
          && checkStartEnd(file, line, row, words[1], words[2], words[0], chromSize, &start, &end)
 	&& checkIntBetween(file, line, row, words[4], "score", 0, 1000)
 	&& checkStrand(file, line, row, words[5])
 	&& (paired ?
 		(checkString(file, line, row, words[3], "name")
 		&& checkSeq(file, line, row, words[6], "seq1")
 		&& checkSeq(file, line, row, words[7], "seq2")
                  && checkMismatchesSeq1Seq2(file, line, words[0], start, end, *words[5], words[6], words[7]))
 	    :
             (checkSeq(file, line, row, words[3], "sequence")
              && checkMismatchesSeq(file, line, words[0], start, end, *words[5], words[3]))
 	    ) )
 	{
 	if (printOkLines)
 	    printf("%s\n", row);
 	}
     else
 	{
 	if (printFailLines)
 	    printf("%s\n", row);
 	if (++errs >= maxErrors)
 	    errAbort("Aborting .. found %d errors\n", errs);
 	}
     }
-dnaChars[(int)'.'] = savedot;
 return errs;
 }
 
 // tagAlign
 // chr1     6082    6117    TCTACTGGCTCTGTGTGTACCAGTCTGTCACTGAG     1000    -
 // chr1     7334    7369    AGCCAGGGGGTGACGTTGTTAGATTAGATTTCTTA     1000    +
 
 int validateTagAlign(struct lineFile *lf, char *file)
 {
 return validateTagOrPairedTagAlign(lf, file, FALSE);
 }
 
 // pairedTagAlign
 // chr10    96316360        96310862        9       1000    +       TCTCACCCGATAACGACCCCCTCCC       TGATCCTTGACTCACTTGCTAATTT
 // chr8    126727657       126721865       10      1000    +       AATTCTTCACCTCTCCTGTTCAAAG       TGTGTGAGATCCAAGAATCCTCTCT
 
 int validatePairedTagAlign(struct lineFile *lf, char *file)
 {
 return validateTagOrPairedTagAlign(lf, file, TRUE);
 }
 
 int validateBedVariant(struct lineFile *lf, char *file, enum bedType type)
 {
 char *row;
 char buf[1024];
 char *words[PEAK_WORDS];
 int line = 0;
 int errs = 0;
 unsigned chromSize;
 int gappedOffset = (type == GAPPED_PEAK ? 6 : 0);
 verbose(2,"[%s %3d] file(%s)\n", __func__, __LINE__, file);
 while (lineFileNextReal(lf, &row))
     {
     ++line;
     unsigned start, end;
     if (quick && line > quick)
 	break;
     safecpy(buf, sizeof(buf), row);
     if ( checkColumns(file, line, row, buf, words, PEAK_WORDS, bedTypeCols[type])
 	&& checkChrom(file, line, row, words[0], &chromSize)
          && checkStartEnd(file, line, row, words[1], words[2], words[0], chromSize, &start, &end)
 	&& ( type == BED_GRAPH ?
 	      (checkFloat(file, line, row, words[3], "value")) // canonical bedGraph has float in 4th column
 	   : // otherwise BROAD_, NARROW_, or GAPPED_PEAK
 	      (checkString(file, line, row, words[3], "name")
 		  && checkIntBetween(file, line, row, words[4], "score", 0, 1000)
 		  && checkStrand(file, line, row, words[5])
 		  // && ((type != GAPPED_PEAK) || ()) // for now dont check all the BED 12 gapped fields
 		  && checkFloat(file, line, row, words[6 + gappedOffset], "signalValue")
 		  && checkFloat(file, line, row, words[7 + gappedOffset], "pValue")
 		  && checkFloat(file, line, row, words[8 + gappedOffset], "qValue")
 		  && ((type != NARROW_PEAK) || (checkPeak(file, line, row, words[9], words[1], words[2])))
 	      )
 	    )
 	)
 	{
 	if (printOkLines)
 	    printf("%s\n", row);
 	}
     else
 	{
 	if (printFailLines)
 	    printf("%s\n", row);
 	if (++errs >= maxErrors)
 	    errAbort("Aborting .. found %d errors\n", errs);
 	}
     }
 return errs;
 }
 
 int validateBroadPeak(struct lineFile *lf, char *file)
 {
 return validateBedVariant(lf, file, BROAD_PEAK);
 }
 
 int validateNarrowPeak(struct lineFile *lf, char *file)
 {
 return validateBedVariant(lf, file, NARROW_PEAK);
 }
 
 int validateGappedPeak(struct lineFile *lf, char *file)
 {
 return validateBedVariant(lf, file, GAPPED_PEAK);
 }
 
 int validateBedGraph(struct lineFile *lf, char *file)
 {
 return validateBedVariant(lf, file, BED_GRAPH);
 }
 
 // fasta:
 // >VHE-245683051005-13-1-2-1704
 // GTGTTAATTTTCTTGATCTTTCGTTC
 // >VHE-245683051005-13-1-2-1704
 // CTTGCTTTCTAGTTCTTTTAATTGTG
 
 int validateFasta(struct lineFile *lf, char *file)
 {
 char *seqName, *seq;
 int line = 0;
 int errs = 0;
 boolean startOfFile = TRUE;
 verbose(2,"[%s %3d] file(%s)\n", __func__, __LINE__, file);
 while ( lineFileNext(lf, &seqName, NULL))
     {
     ++line;
     if (quick && line > quick)
 	break;
     if (startOfFile)
 	{
 	if (*seqName == '#')
 	    continue;
 	else
 	    startOfFile = FALSE;
 	}
     if (checkSeqName(file, line, seqName, '>', "sequence name")
 	&& (wantNewLine(lf, file, ++line, &seq, "fastq sequence line"))
 	&& checkSeq(file, line, seq, seq, "sequence") )
 	{
 	if (printOkLines)
 	    printf("%s\n%s\n", seqName, seq);
 	}
     else
 	{
 	if (printFailLines)
 	    printf("%s\n%s\n", seqName, seq);
 	if (++errs >= maxErrors)
 	    errAbort("Aborting .. found %d errors\n", errs);
 	}
     }
 return errs;
 }
 
 // fastq:
 // @NINA_1_FC30G3VAAXX:5:1:110:908
 // ATCGTCAGGTGGGATAATCCTTACCTTTTCCTCCTC
 // +NINA_1_FC30G3VAAXX:5:1:110:908
 // aa`]`a`XQ^VQQ^`aaaaaaa^[[ZG[aXUX[[[X
 
 int validateFastq(struct lineFile *lf, char *file)
 {
 char *seqName, *seq, *qName, *qual;
 int line = 0;
 int errs = 0;
 boolean startOfFile = TRUE;
 verbose(2,"[%s %3d] file(%s)\n", __func__, __LINE__, file);
 while ( lineFileNext(lf, &seqName, NULL))
     {
     ++line;
     if (quick && line > quick)
 	break;
     if (startOfFile)
 	{
 	if (*seqName == '#')
 	    continue;
 	else
 	    startOfFile = FALSE;
 	}
     if (checkSeqName(file, line, seqName, '@', "sequence name")
 	&& (wantNewLine(lf, file, ++line, &seq, "fastq sequence line"))
 	&& checkSeq(file, line, seq, seq, "sequence")
 	&& (wantNewLine(lf, file, ++line, &qName, "fastq sequence name (quality line)"))
 	&& checkSeqName(file, line, qName, '+', "quality name")
 	&& (wantNewLine(lf, file, ++line, &qual, "quality line"))
 	&& checkQual(file, line, qual) )
 	{
 	if (printOkLines)
 	    printf("%s\n%s\n%s\n%s\n", seqName, seq, qName, qual);
 	}
     else
 	{
 	if (printFailLines)
 	    printf("%s\n%s\n%s\n%s\n", seqName, seq, qName, qual);
 	if (++errs >= maxErrors)
 	    errAbort("Aborting .. found %d errors\n", errs);
 	}
     }
 return errs;
 }
 
 /*    Syntax per http://marketing.appliedbiosystems.com/mk/submit/SOLID_KNOWLEDGE_RD?_JS=T&rd=dm
 CS Fasta:
 >461_19_209_F3
 T022213002230311203200200322000
 >920_22_656_F3,1.-152654094.1.35.35.0###,19.43558664.1.35.35.0###
 T01301010111200210102321210100112312
 */
 
 int validateCsfasta(struct lineFile *lf, char *file)
 // Validate Colorspace fasta files
 {
 char *seqName = NULL;
 char *seq = NULL;
 int line = 0;
 int errs = 0;
 boolean startOfFile = TRUE;
 verbose(2,"[%s %3d] file(%s)\n", __func__, __LINE__, file);
 while (lineFileNext(lf, &seqName, NULL))
     {
     ++line;
     if (quick && line > quick)
 	break;
     if (startOfFile)
 	{
 	if (*seqName == '#')
 	    continue;
 	else
 	    startOfFile = FALSE;
 	}
     if (checkCsSeqName(file, line, seqName)
 	&& (wantNewLine(lf, file, ++line, &seq, "colorspace sequence name"))
 	&& checkSeq(file, line, seq, seq, "colorspace sequence") )
 	{
 	if (printOkLines)
 	    printf("%s\n%s\n", seqName, seq);
 	}
     else
 	{
 	if (printFailLines)
 	    printf("%s\n%s\n", seqName, seq);
 	if (++errs >= maxErrors)
 	    errAbort("Aborting .. found %d errors\n", errs);
 	}
     }
 return errs;
 }
 
 
 /*    Syntax per http://marketing.appliedbiosystems.com/mk/submit/SOLID_KNOWLEDGE_RD?_JS=T&rd=dm
     Sample:-
 
 # Cwd: /home/pipeline
 # Title: S0033_20080723_2_I22_EA_
 >461_19_90_F3
 20 10 8 13 8 10 20 7 7 24 15 22 21 14 14 8 11 15 5 20 6 5 8 22 6 24 3 16 7 11
 >461_19_209_F3
 16 8 5 12 20 24 19 8 13 17 11 23 8 24 8 7 17 4 20 8 29 7 3 16 3 4 8 20 17 9
 */
 
 int validateCsqual(struct lineFile *lf, char *file)
 // Validate Colorspace quality files
 {
 char *seqName = NULL;
 char *qual = NULL;
 int line = 0;
 int errs = 0;
 boolean startOfFile = TRUE;
 verbose(2,"[%s %3d] file(%s)\n", __func__, __LINE__, file);
 while (lineFileNext(lf, &seqName, NULL))
     {
     ++line;
     if (quick && line > quick)
 	break;
     if (startOfFile)
 	{
 	if (*seqName == '#')
 	    continue;
 	else
 	    startOfFile = FALSE;
 	}
     if (checkCsSeqName(file, line, seqName)
 	&& (wantNewLine(lf, file, ++line, &qual, "colorspace quality line"))
 	&& checkCsQual(file, line, qual) )
 	{
 	if (printOkLines)
 	    printf("%s\n%s\n", seqName, qual);
 	}
     else
 	{
 	if (printFailLines)
 	    printf("%s\n%s\n", seqName, qual);
 	if (++errs >= maxErrors)
 	    errAbort("Aborting .. found %d errors\n", errs);
 	}
     }
 return errs;
 }
 
 void validateFiles(int (*validate)(struct lineFile *lf, char *file), int numFiles, char *files[])
 /* validateFile - validate format of different track input files. */
 {
 int i;
 int errs = 0;
 verbose(2,"[%s %3d] numFiles=%d \n", __func__, __LINE__, numFiles);
 for (i = 0; i < numFiles ; ++i)
     {
     struct lineFile *lf = lineFileOpen(files[i], TRUE);
     errs += validate(lf, files[i]);
     lineFileClose(&lf);
     }
 verbose(2,"[%s %3d] done loop\n", __func__, __LINE__);
 if (errs > 0)
     errAbort("Aborting ... found %d errors in total\n", errs);
 verbose(2,"[%s %3d] done\n", __func__, __LINE__);
 
 }
 
 int testFunc(char *f)
 {
 char *row;
 int size;
 struct lineFile *lf = lineFileOpen(f, TRUE);
 while (lineFileNext(lf, &row, &size))
     printf("size=%d [%s]\n", size, row);
 printf("done.\n");
 return 0;
 }
 
 int main(int argc, char *argv[])
 /* Process command line. */
 {
 char *type;
 void *func;
 struct chromInfo *ci = NULL;
 struct hash *funcs = newHash(0);
 char *chromDb, *chromInfo;
 optionInit(&argc, argv, options);
 ++argv;
 --argc;
 if (optionExists("version"))
     errAbort("%s", version);
 if (argc==0)
     usage();
 type = optionVal("type", "");
 if (strlen(type) == 0)
     errAbort("please specify type");
 maxErrors      = optionInt("maxErrors", MAX_ERRORS);
 zeroSizeOk     = optionExists("zeroSizeOk");
 chrMSizeOk     = optionExists("chrMSizeOk");
 printOkLines   = optionExists("printOkLines");
 printFailLines = optionExists("printFailLines");
 genome         = optionExists("genome") ? twoBitOpen(optionVal("genome",NULL)) : NULL;
 mismatches     = optionInt("mismatches",0);
 matchFirst     = optionInt("matchFirst",0);
 mmPerPair      = optionExists("mmPerPair");
 nMatch         = optionExists("nMatch");
 isSort         = optionExists("isSort");
 mmCheckOneInN  = optionInt("mmCheckOneInN", 1);
 quick          = optionExists("quick") ? optionInt("quick",QUICK_DEFAULT) : 0;
 colorSpace     = optionExists("colorSpace") || sameString(type, "csfasta");
+
 initArrays();
+dnaChars[(int)'.'] = 1;//optionExists("acceptDot");   // I don't think this is worth adding another option.  But it could be done.
+
 // Get chromInfo from DB or file
 if ( (chromDb = optionVal("chromDb", NULL)) != NULL)
     {
     if (!(ci = createChromInfoList(NULL, chromDb)))
         errAbort("could not load chromInfo from DB %s\n", chromDb);
     chrHash = chromHash(ci);
     chromInfoFree(&ci);
     }
 else if ( (chromInfo=optionVal("chromInfo", NULL)) != NULL)
     {
     if (!(ci = chromInfoLoadAll(chromInfo)))
 	errAbort("could not load chromInfo file %s\n", chromInfo);
     chrHash = chromHash(ci);
     chromInfoFree(&ci);
     }
 verbose(2,"[%s %3d] type=%s\n", __func__, __LINE__, type);
 // Setup the function hash keyed by type
 hashAdd(funcs, "tagAlign",       &validateTagAlign);
 hashAdd(funcs, "pairedTagAlign", &validatePairedTagAlign);
 hashAdd(funcs, "fasta",          &validateFasta);
 hashAdd(funcs, "fastq",          &validateFastq);
 hashAdd(funcs, "csfasta",        &validateCsfasta);
 hashAdd(funcs, "csqual",         &validateCsqual);
 hashAdd(funcs, "broadPeak",      &validateBroadPeak);
 hashAdd(funcs, "narrowPeak",     &validateNarrowPeak);
 hashAdd(funcs, "gappedPeak",     &validateGappedPeak);
 hashAdd(funcs, "bedGraph",       &validateBedGraph);
 //hashAdd(funcs, "test", &testFunc);
 if (!(func = hashFindVal(funcs, type)))
     errAbort("Cannot validate %s type files\n", type);
 validateFiles(func, argc, argv);
 return 0;
 }