d41531259de6cb8aafd3b0d336518f2e8d6cfb61 markd Tue May 26 17:13:04 2020 -0700 Hiram is right, this is useless; what is really needed is for mafOrder to have an option to orient the reference sequence to the positive strand diff --git src/hg/ratStuff/mafRc/expected/test1-rc.maf src/hg/ratStuff/mafRc/expected/test1-rc.maf deleted file mode 100644 index 35a2a2b..0000000 --- src/hg/ratStuff/mafRc/expected/test1-rc.maf +++ /dev/null @@ -1,13 +0,0 @@ -##maf version=1 -a score=26765.000000 -s ce6.chrII 631706 49 - 15279323 GAAGGGCAAATGCGAATTGACAACTACCGTGAAGTCGACGGTCGGAGCA -s caeJap1.chrUn 119690416 49 - 156378573 GAGGGTCAAATGAAGGTGGACAACCATCGAGAAGTGACTGGTCGTAGCA -i caeJap1.chrUn C 0 C 0 -s caePb2.chrUn 129983751 49 - 194283334 GAAGgtctgatgaaaattgataatcatCGTGAAGTGAATGGTAGAAGTA -i caePb2.chrUn C 0 C 0 -s caeRem3.chrUn 30066981 49 - 149111736 GAGGGTCAAATGAGAATTGACAACCACCGAGAAGTCAACGGAAGGAGTA -i caeRem3.chrUn C 0 C 0 -s cb3.chrII_random 2198667 49 - 2252910 GAAGGTCAAATGAAAATCGATAATTATCGAGAAATCAATGGAAGAAGTA -i cb3.chrII_random C 0 C 0 -e priPac1.chrUn 61628081 579 + 174852139 I -