6b9b7637b977bdc62cb2d447e3a6c2766cac414c
galt
  Thu Mar 18 14:45:26 2021 -0700
Make dynamic blat explanation very minimal. refs #26658

diff --git src/hg/hgBlat/hgBlat.c src/hg/hgBlat/hgBlat.c
index cfae2bb..d30f017 100644
--- src/hg/hgBlat/hgBlat.c
+++ src/hg/hgBlat/hgBlat.c
@@ -1753,31 +1753,31 @@
     "document.mainForm.submit();";
 
 char *userSeq = NULL;
 char *type = NULL;
 
 printf( 
 "<FORM ACTION=\"../cgi-bin/hgBlat\" METHOD=\"POST\" ENCTYPE=\"multipart/form-data\" NAME=\"mainForm\">\n"
 "<H2>BLAT Search Genome</H2>\n");
 cartSaveSession(cart);
 puts("\n");
 puts("<INPUT TYPE=HIDDEN NAME=changeInfo VALUE=\"\">\n");
 puts("<TABLE class='hgBlatTable' BORDER=0 WIDTH=80>\n");
 printf("<TR>\n");
 printf("<TD ALIGN=CENTER style='overflow:hidden;white-space:nowrap;'>Genome:");
 printf(" <INPUT TYPE=CHECKBOX id=allGenomes NAME=allGenomes VALUE=\"\">");
-printf(" <span id=searchAllText> Search all genomes on dedicated BLAT servers.<span>");
+printf(" <span id=searchAllText> Search all<span>");
 printf("</TD>");
 // clicking on the Search ALL text clicks the checkbox.
 jsOnEventById("click", "searchAllText", 
     "document.mainForm.allGenomes.click();"
     "return false;"   // cancel the default
     );
 
 printf("<TD ALIGN=CENTER>Assembly:</TD>");
 printf("<TD ALIGN=CENTER>Query type:</TD>");
 printf("<TD ALIGN=CENTER>Sort output:</TD>");
 printf("<TD ALIGN=CENTER>Output type:</TD>");
 printf("<TD ALIGN=CENTER>&nbsp</TD>");
 printf("</TR>\n");
 
 printf("<TR>\n");
@@ -1836,33 +1836,31 @@
 puts("<BR><B>File Upload:</B> ");
 puts("Rather than pasting a sequence, you can choose to upload a text file containing "
 	 "the sequence.<BR>");
 puts("Upload sequence: <INPUT TYPE=FILE NAME=\"seqFile\">");
 puts(" <INPUT TYPE=SUBMIT Name=Submit VALUE=\"submit file\"><P>\n");
 printf("%s", 
 "<P>Only DNA sequences of 25,000 or fewer bases and protein or translated \n"
 "sequence of 10000 or fewer letters will be processed.  Up to 25 sequences\n"
 "can be submitted at the same time. The total limit for multiple sequence\n"
 "submissions is 50,000 bases or 25,000 letters.<br> A valid example "
 "is <tt>GTCCTCGGAACCAGGACCTCGGCGTGGCCTAGCG</tt> (human SOD1).\n</P>\n");
 
 printf("%s", 
 "<P>The <b>Search all</b> checkbox allows you to search all genomes at the same time. "
 "Search all is only available for default assemblies and attached hubs with dedicated BLAT servers."
-"The new dynamic BLAT servers enable searching on unlimited numbers of genomes "
-"using a fixed amount of memory. However, because of the time required to swap, assemblies on dynamic servers are not searched, "
-"but are noted as skipped in the output.\n");
+"The new dynamic BLAT servers are not supported, and they are noted as skipped in the output.\n");
 
 printf("<P>The <b>All Results</b> checkbox disables minimum matches filtering so all results are seen." 
 " For example, with a human dna search, 20 is minimum matches required, based on the genome size, to filter out lower-quality results.\n"
 "This checkbox can be useful with short queries and with the tiny genomes of microorganisms. \n"
 );
 
 if (hgPcrOk(db))
     printf("<P>For locating PCR primers, use <A HREF=\"../cgi-bin/hgPcr?db=%s\">In-Silico PCR</A>"
            " for best results instead of BLAT.</P>", db);
 puts("</TD></TR></TABLE>\n");
 
 
 
 printf("</FORM>\n");
 
@@ -2294,38 +2292,31 @@
 			"return false;"   // cancel the default link url
 			, gH->genome, gH->db
 			);
 		    idCount++;
 		    }
 	    
 		printf("</TR>\n");
 		}
 	    printf("</TABLE><br>\n");
 
 	    if (debuggingGfResults)
 		printDebugging();
 
 	    if (hubDynamicBlatServerCount > 0 || nonHubDynamicBlatServerCount > 0) 
 		{
-		printf("Dedicated static BLAT servers are fast but require lots of memory, processors and machines.<br>\n"
-		    "Dynamic BLAT servers only require disk space, and can support an unlimited numbers of genomes,<br>\n"
-		    "however they take time to swap indexes into memory and have limited parallelism.<br>\n"
-		    "The BLAT All Genomes feature does not currently support dynamic BLAT servers.<br>\n");
-		if (nonHubDynamicBlatServerCount > 0)
-		    printf( "Number of dynamic BLAT genomes at this site: %d<br>\n", nonHubDynamicBlatServerCount);
-		if (hubDynamicBlatServerCount > 0)
-	  	    printf( "Number of dynamic BLAT genomes on attached hubs: %d<br>\n", hubDynamicBlatServerCount);
+		printf("The BLAT All Genomes feature does not currently support dynamic BLAT servers.<br>\n");
 		}
 	    printf( "<br>\n");
 
 	    fakeAskForSeqForm(organism, db);
 	    }
 	else
 	    {
 	    printf("No input sequences provided.<br><br>\n");
 	    }
 
 	cartWebEnd();
 	}
     else
 	blatSeq(skipLeadingSpaces(userSeq), organism, db, 0);
     }