cf45361ec82056f4fac5342e94b16c6e437c58e9
galt
  Thu Mar 18 16:47:52 2021 -0700
finishing touches on hgBlat Search All verbiage and FAQ links added. refs #26658

diff --git src/hg/hgBlat/hgBlat.c src/hg/hgBlat/hgBlat.c
index 86fdc81..72f7778 100644
--- src/hg/hgBlat/hgBlat.c
+++ src/hg/hgBlat/hgBlat.c
@@ -1836,31 +1836,33 @@
 puts("<BR><B>File Upload:</B> ");
 puts("Rather than pasting a sequence, you can choose to upload a text file containing "
 	 "the sequence.<BR>");
 puts("Upload sequence: <INPUT TYPE=FILE NAME=\"seqFile\">");
 puts(" <INPUT TYPE=SUBMIT Name=Submit VALUE=\"submit file\"><P>\n");
 printf("%s", 
 "<P>Only DNA sequences of 25,000 or fewer bases and protein or translated \n"
 "sequence of 10000 or fewer letters will be processed.  Up to 25 sequences\n"
 "can be submitted at the same time. The total limit for multiple sequence\n"
 "submissions is 50,000 bases or 25,000 letters.<br> A valid example "
 "is <tt>GTCCTCGGAACCAGGACCTCGGCGTGGCCTAGCG</tt> (human SOD1).\n</P>\n");
 
 printf("%s", 
 "<P>The <b>Search all</b> checkbox allows you to search all genomes at the same time. "
 "Search all is only available for default assemblies and attached hubs with dedicated BLAT servers."
-"The new dynamic BLAT servers are not supported, and they are noted as skipped in the output.\n");
+"The new dynamic BLAT servers are not supported, and they are noted as skipped in the output. "
+"<b>See our <a href='/FAQ/FAQblat.html#blat9'>BLAT All FAQ</a> for more information.</b>\n"
+);
 
 printf("<P>The <b>All Results</b> checkbox disables minimum matches filtering so all results are seen." 
 " For example, with a human dna search, 20 is minimum matches required, based on the genome size, to filter out lower-quality results.\n"
 "This checkbox can be useful with short queries and with the tiny genomes of microorganisms. \n"
 );
 
 if (hgPcrOk(db))
     printf("<P>For locating PCR primers, use <A HREF=\"../cgi-bin/hgPcr?db=%s\">In-Silico PCR</A>"
            " for best results instead of BLAT.</P>", db);
 puts("</TD></TR></TABLE>\n");
 
 
 
 printf("</FORM>\n");
 
@@ -2292,31 +2294,32 @@
 			"return false;"   // cancel the default link url
 			, gH->genome, gH->db
 			);
 		    idCount++;
 		    }
 	    
 		printf("</TR>\n");
 		}
 	    printf("</TABLE><br>\n");
 
 	    if (debuggingGfResults)
 		printDebugging();
 
 	    if (hubDynamicBlatServerCount > 0 || nonHubDynamicBlatServerCount > 0) 
 		{
-		printf("The BLAT All Genomes feature does not currently support dynamic BLAT servers.<br>\n");
+		printf("The BLAT All Genomes feature does not currently support dynamic BLAT servers. "
+		"<b>See our <a href='/FAQ/FAQblat.html#blat9'>BLAT All FAQ</a> for more information.</b><br>\n");
 		}
 	    printf( "<br>\n");
 
 	    fakeAskForSeqForm(organism, db);
 	    }
 	else
 	    {
 	    printf("No input sequences provided.<br><br>\n");
 	    }
 
 	cartWebEnd();
 	}
     else
 	blatSeq(skipLeadingSpaces(userSeq), organism, db, 0);
     }