\n"); printf("%s", "
Only DNA sequences of 25,000 or fewer bases and protein or translated \n"
"sequence of 10000 or fewer letters will be processed. Up to 25 sequences\n"
"can be submitted at the same time. The total limit for multiple sequence\n"
"submissions is 50,000 bases or 25,000 letters.
A valid example "
"is GTCCTCGGAACCAGGACCTCGGCGTGGCCTAGCG (human SOD1).\n
The Search all checkbox allows you to search all genomes at the same time. " "Search all is only available for default assemblies and attached hubs with dedicated BLAT servers." "The new dynamic BLAT servers enable searching on unlimited numbers of genomes " -"using a fixed amount of memory. However, because of the time required to swap, those assemblies are skipped, " -"and do not appear in the output.\n"); +"using a fixed amount of memory. However, because of the time required to swap, assemblies on dynamic servers are not searched, " +"but are noted as skipped in the output.\n"); printf("
The All Results checkbox disables minimum matches filtering so all results are seen." " For example, with a human dna search, 20 is minimum matches required, based on the genome size, to filter out lower-quality results.\n" "This checkbox can be useful with short queries and with the tiny genomes of microorganisms. \n" ); if (hgPcrOk(db)) printf("
For locating PCR primers, use In-Silico PCR" " for best results instead of BLAT.
", db); puts("\n"); printf("\n");