ef932f66f1608a5cbe6840662be9aa1b67ae95bd brianlee Fri Apr 16 09:27:27 2021 -0700 Adding a PCR forward/reverse sequence example as proof of concept for Assembly Hub PCR after Max note in Progress Report about working on laptops. diff --git src/hg/htdocs/goldenPath/help/hubQuickStartAssembly.html src/hg/htdocs/goldenPath/help/hubQuickStartAssembly.html index 91f4c5f..ca96c17 100755 --- src/hg/htdocs/goldenPath/help/hubQuickStartAssembly.html +++ src/hg/htdocs/goldenPath/help/hubQuickStartAssembly.html @@ -219,17 +219,23 @@

Run the two gfServer commands to start the blat servers:

gfServer start localhost 17777 -trans -mask araTha1.2bit &
 gfServer start localhost 17779 -stepSize=5 araTha1.2bit & 

STEP 8. Load this plant assembly hub by using this URL and selecting it under the "group" category where "Plant araTha1" displays:

http://127.0.0.1:1234/cgi-bin/hgGateway?genome=araTha1&hubUrl=http://127.0.0.1:1234/folders/hubExamples/hubAssembly/plantAraTha1/hub.txt

On the blat page, http://127.0.0.1:1234/cgi-bin/hgBlat, you can now select the Arabidopsis thaliana assembly and blat plant amino acid sequences, like IYQTRENKYIIGEIQITESERDRRRSSLPGNH or DNA sequences, like TAAGTAAAAAATAATATGATTAAGACTAATAAATCTTAATAGTTAATACT. - +

+

On the PCR page, http://127.0.0.1:1234/cgi-bin/hgPcr, you can now select the +Arabidopsis thaliana genome and enter a forward primer such as +TAGGTCTGCACCTGTGGTTCAAAATTTT and a reverse primer such as +CAATACAAGTCAACATTTTAGCGCCGAGA and click the "Flip Reverse Primer" +box and then click submit to find matches on the assembly.