This URL should work the same as using the original data just copied:
http://genome.ucsc.edu/cgi-bin/hgHubConnect?hgHub_do_redirect=on&hgHubConnect.remakeTrackHub=on&hgHub_do_firstDb=1&hubUrl=http://genome.ucsc.edu/goldenPath/help/examples/hubExamples/hubAssembly/plantAraTha1/hub.txt STEP 3: Congratulations! Your assembly hub should display!
If you are having problems, be sure all your files and the directories are publicly accessible. You may also wish to reset the browser occasionally to clear all existing data. For hubs to work, your server must also accept byte-ranges. You can check using the following command to verify "Accept-Ranges: bytes" displays:
curl -I http://yourURL/hub.txtNow that you have the assembly hub copied from above, you can copy the directory and start to edit -some of the documents like genomes.txt, groups.txt, and trackDb.txt to understand how they work. +some of the documents such as genomes.txt, groups.txt, and trackDb.txt to understand how they work. Refer to the Assembly Hub Wiki to understand how to build a twoBit file for your own original fasta files. Read more about trackDb settings in the definition document.
This assembly hub is a an abbreviated version of a larger plant assembly Public Hub. You can explore the larger hub structure here.
Please note that the Browser waits 5 minutes before checking for any changes to these files.
When editing hub.txt, genomes.txt, trackDb.txt, and related hub files, shorten this delay by
adding udcTimeout=1 to your URL. For more information, please see the
Debugging and Updating Track Hubs section of
the Track Hub User Guide. Also, for more detailed
instructions on setting up a regular hub, please see the
STEP 7. Change directories to the 2bit file:
cd /folders/hubExamples/hubAssembly/plantAraTha1/araTha1Run the two gfServer commands to start the blat servers:
gfServer start localhost 17777 -trans -mask araTha1.2bit &
gfServer start localhost 17779 -stepSize=5 araTha1.2bit & STEP 8. Load this plant assembly hub by using this URL and selecting it under the "group" category where "Plant araTha1" displays:
http://127.0.0.1:1234/cgi-bin/hgGateway?genome=araTha1&hubUrl=http://127.0.0.1:1234/folders/hubExamples/hubAssembly/plantAraTha1/hub.txt
On the blat page, http://127.0.0.1:1234/cgi-bin/hgBlat, you can now select the
-Arabidopsis thaliana assembly and blat plant amino acid sequences, like
+Arabidopsis thaliana assembly and blat plant amino acid sequences, such as
IYQTRENKYIIGEIQITESERDRRRSSLPGNH
-or DNA sequences, like TAAGTAAAAAATAATATGATTAAGACTAATAAATCTTAATAGTTAATACT.
+or DNA sequences, such as TAAGTAAAAAATAATATGATTAAGACTAATAAATCTTAATAGTTAATACT.
On the PCR page, http://127.0.0.1:1234/cgi-bin/hgPcr, you can now select the
Arabidopsis thaliana genome and enter a forward primer such as
TAGGTCTGCACCTGTGGTTCAAAATTTT and a reverse primer such as
CAATACAAGTCAACATTTTAGCGCCGAGA and click the "Flip Reverse Primer"
box and then click submit to find matches on the assembly.