d308fe7147b78ac8c4e5344c797ccab3f60ef07d
kuhn
  Tue Apr 20 12:22:44 2021 -0700
grammar nit

diff --git src/hg/htdocs/goldenPath/help/hubQuickStartAssembly.html src/hg/htdocs/goldenPath/help/hubQuickStartAssembly.html
index ca96c17..816710e 100755
--- src/hg/htdocs/goldenPath/help/hubQuickStartAssembly.html
+++ src/hg/htdocs/goldenPath/help/hubQuickStartAssembly.html
@@ -41,31 +41,31 @@
 </code>
 <p>
 This URL should work the same as using the original data just copied:</p>
 <pre><code><a href="http://genome.ucsc.edu/cgi-bin/hgHubConnect?hgHub_do_redirect=on&hgHubConnect.remakeTrackHub=on&hgHub_do_firstDb=1&hubUrl=http://genome.ucsc.edu/goldenPath/help/examples/hubExamples/hubAssembly/plantAraTha1/hub.txt"
 target="_blank">http://genome.ucsc.edu/cgi-bin/hgHubConnect?hgHub_do_redirect=on&hgHubConnect.remakeTrackHub=on&hgHub_do_firstDb=1&<strong>hubUrl=http://genome.ucsc.edu/goldenPath/help/examples/hubExamples/hubAssembly/plantAraTha1/hub.txt</strong></a> </code></pre>
 <p>
 <strong>STEP 3:</strong> Congratulations! Your assembly hub should display!</p>
 <p>
 If you are having problems, be sure all your files and the directories are publicly accessible. You 
 may also wish to <a href="../../cgi-bin/cartReset" target="_blank">reset</a> the browser 
 occasionally to clear all existing data. For hubs to work, your server must also accept 
 byte-ranges. You can check using the following command to verify &quot;Accept-Ranges: bytes&quot;
 displays: <pre><code>curl -I http://yourURL/hub.txt</code></pre></p>
 <p>
 Now that you have the assembly hub copied from above, you can copy the directory and start to edit 
-some of the documents like genomes.txt, groups.txt, and trackDb.txt to understand how they work. 
+some of the documents such as genomes.txt, groups.txt, and trackDb.txt to understand how they work. 
 Refer to the <a href="http://genomewiki.ucsc.edu/index.php/Assembly_Hubs" target="_blank">Assembly 
 Hub Wiki</a> to understand how to build a <a href="twoBit.html" target="_blank">twoBit</a> file for 
 your own original fasta files. Read more about <a href="trackDb/trackDbHub.html"
 target="_blank">trackDb settings</a> in the definition document.</p>
 <p>
 This assembly hub is a an abbreviated version of a larger plant assembly Public Hub.  You can 
 explore the larger hub structure <a href="http://genome-test.soe.ucsc.edu/~hiram/hubs/Plants/" 
 target="_blank">here</a>.</p>
 <p>
 Please note that the Browser waits 5 minutes before checking for any changes to these files. 
 <strong>When editing hub.txt, genomes.txt, trackDb.txt, and related hub files, shorten this delay by
 adding <code>udcTimeout=1</code> to your URL.</strong> For more information, please see the 
 <a href="hgTrackHubHelp.html#Debug" target="_blank">Debugging and Updating Track Hubs</a> section of
 the <a href="hgTrackHubHelp.html" target="_blank">Track Hub User Guide</a>. Also, for more detailed 
 instructions on setting up a regular hub, please see the <a href="hgTrackHubHelp.html#Setup" 
@@ -216,26 +216,26 @@
 <p>
 <strong>STEP 7.</strong> Change directories to the 2bit file:</p>
 <pre><code>cd /folders/hubExamples/hubAssembly/plantAraTha1/araTha1</code></pre> 
 <p>
 Run the two gfServer commands to start the blat servers:</p>
 <pre><code>gfServer start localhost 17777 -trans -mask araTha1.2bit &
 gfServer start localhost 17779 -stepSize=5 araTha1.2bit & </code></pre>
 <p>
 <strong>STEP 8.</strong> Load this plant assembly hub by using this URL and selecting it under the 
 &quot;group&quot; category where &quot;Plant araTha1&quot; displays:</p>
 <pre><code><a href="http://127.0.0.1:1234/cgi-bin/hgGateway?genome=araTha1&hubUrl=http://127.0.0.1:1234/folders/hubExamples/hubAssembly/plantAraTha1/hub.txt"
 target="_blank">http://127.0.0.1:1234/cgi-bin/hgGateway?genome=araTha1&amp;hubUrl=http://127.0.0.1:1234/folders/hubExamples/hubAssembly/plantAraTha1/hub.txt</a></code></pre>
 <p>
 On the blat page, <code><a href="http://127.0.0.1:1234/cgi-bin/hgBlat" 
 target="_blank">http://127.0.0.1:1234/cgi-bin/hgBlat</a></code>, you can now select the 
-<em>Arabidopsis thaliana</em> assembly and blat plant amino acid sequences, like
+<em>Arabidopsis thaliana</em> assembly and blat plant amino acid sequences, such as
 <code>IYQTRENKYIIGEIQITESERDRRRSSLPGNH</code>
-or DNA sequences, like <code>TAAGTAAAAAATAATATGATTAAGACTAATAAATCTTAATAGTTAATACT</code>.
+or DNA sequences, such as <code>TAAGTAAAAAATAATATGATTAAGACTAATAAATCTTAATAGTTAATACT</code>.
 </p>
 <p>On the PCR page, <code><a href="http://127.0.0.1:1234/cgi-bin/hgPcr"
 target="_blank">http://127.0.0.1:1234/cgi-bin/hgPcr</a></code>, you can now select the
 <em>Arabidopsis thaliana</em> genome and enter a forward primer such as
 <code>TAGGTCTGCACCTGTGGTTCAAAATTTT</code> and a reverse primer such as
 <code>CAATACAAGTCAACATTTTAGCGCCGAGA</code> and click the &quot;Flip Reverse Primer&quot;
 box and then click submit to find matches on the assembly.</p>
 <!--#include virtual="$ROOT/inc/gbPageEnd.html" -->