436dedc0123ecccf59296615c87beccb3ecdb8bd
dschmelt
  Tue Oct 26 17:55:03 2021 -0700
Updating query examples with new ones and removing an old broken one refs #28072

diff --git src/hg/htdocs/goldenPath/help/query.html src/hg/htdocs/goldenPath/help/query.html
index 8ecbd8b..656eaf1 100755
--- src/hg/htdocs/goldenPath/help/query.html
+++ src/hg/htdocs/goldenPath/help/query.html
@@ -51,53 +51,61 @@
 
 <h2>Sample queries</h2> 
 <p> 
 Below is a list of examples that might be used to query the Genome Browser. Note that not every 
 query listed here will produce a result in every assembly. The list serves only to illustrate the 
 different types of queries that can be performed.  
 <table border="1"> 
   <tr><th width="200">Query</th><th>Genome Browser Response</th></tr> 
   <tr>
     <td>chr7</td>
     <td>Displays all of chromosome 7</td></tr> 
   <tr>
     <td>chr3:1-1000000</td>
     <td>Displays the first million bases of chromosome 3, counting from the p-arm telomere</td></tr>
   <tr>
+    <td>3:1-1000000</td>
+    <td>Displays the first million bases of chromosome 3, Ensembl format chromosome names</td></tr>
+  <tr>
+    <td>chr3 0 1000000</td>
+    <td>Displays the first million bases of chromosome 3; BED format</td></tr>
+  <tr>
+    <td>NC_000007.14:1-1000000</td>
+    <td>Displays the first million bases of chromosome 3, RefSeq format</td></tr>
+  <tr>
+    <td>CM000665.2:1-1000000</td>
+    <td>Displays the first million bases of chromosome 3, GenBank/INSDC format</td></tr>
+  <tr>
     <td>chr3:1000000+2000</td>
     <td>Displays a region of chromosome 3 that spans 2000 bases, starting with position 1000000</td>
     </tr> 
   <tr>
     <td>chrUn_GL000213v1</td>
     <td>Displays all of the unplaced contig GL000213v1</td></tr>
   <tr>
     <td>chr3_GL000221v1_random</td>
     <td>Displays the unlocalized contig GL000221v1</td></tr>
   <tr>
     <td>chr1_KN196472v1_fix</td>
     <td>Displays all of patch fix KN196472v1</td></tr>
   <tr>
     <td>20p13</td>
     <td>Displays the region for band p13 on chromosome 20</td></tr> 
   <tr>
   <tr>
     <td>GTATGTAGCCACGGAGCACCATTACCTGTCACCATTACCTGAATGGCTA</td>
-    <td>Displays the first best match to this DNA sequence, e.g. chr21:33034835-33034883 for hg19</td>
-  </tr> 
-  <tr>
-    <td>374180</td>
-    <td>Displays the region containing Entrez Gene identifier 374180</td></tr> 
+    <td>Displays the first best match to this DNA sequence, e.g. chr21:33034835-33034883 for hg19</td></tr> 
   <tr>
     <td>AA205474</td>
     <td>Displays the region containing the EST with GenBank accession AA205474 in the BRCA1 cancer 
     gene on chromosome 17</td></tr> 
   <tr>
     <td>AC008101</td>
     <td>Displays the region containing the clone with GenBank accession AC008101</td></tr> 
   <tr>
     <td>AF083811</td>
     <td>Displays the region containing the mRNA with GenBank accession number AF083811</td></tr> 
   <tr>
     <td>NM_017414</td>
     <td>Displays the region containing RefSeq identifier NM_017414</td></tr> 
   <tr>
     <td>NP_059110</td>