4898794edd81be5285ea6e544acbedeaeb31bf78 max Tue Nov 23 08:10:57 2021 -0800 Fixing pointers to README file for license in all source code files. refs #27614 diff --git src/hg/visiGene/vgLoadAllen/vgLoadAllen.c src/hg/visiGene/vgLoadAllen/vgLoadAllen.c index 7e966d3..c68e351 100644 --- src/hg/visiGene/vgLoadAllen/vgLoadAllen.c +++ src/hg/visiGene/vgLoadAllen/vgLoadAllen.c @@ -1,255 +1,255 @@ /* vgLoadAllen - Create .ra and .tab files for loading Allen Brain Atlas images into VisiGene. */ /* Copyright (C) 2011 The Regents of the University of California - * See README in this or parent directory for licensing information. */ + * See kent/LICENSE or http://genome.ucsc.edu/license/ for licensing information. */ #include "common.h" #include "linefile.h" #include "hash.h" #include "options.h" #include "obscure.h" #include "portable.h" #include "jpegSize.h" #include "dnaseq.h" #include "fa.h" void usage() /* Explain usage and exit. */ { errAbort( "vgLoadAllen - Create .ra and .tab files for loading Allen Brain Atlas images\n" "into VisiGene\n" "usage:\n" " vgLoadAllen sourceImageDir allen.tab probes.fa name.tab outDir\n" "where sourceImageDir is the full-size jpg image dir converted from the ABA image Disk\n" "allen.tab is the ABA input \n" "probes.fa contains the sequence of all the probes\n" "name.tab is two columns: biological name and the aba probe id (used with the gene sorter)\n" "outputDir is where the output .ra and tab files go.\n" "options:\n" " -xxx=XXX\n" ); } /* vgLoadAllen sourceImageDir = /san/sanvol1/visiGene/gbdb/full/inSitu/Mouse/allenBrain (if san is down can use /cluster/store11/visiGene/offline/allenBrain/imageDisk with .jp2) allen.tab = /cluster/store11/visiGene/offline/allenBrain/probesAndData/allen20051021.tab probes.fa = /cluster/data/mm7/bed/allenBrain/allProbes.fa name.tab = /cluster/data/mm7/bed/allenBrain/allProbes.tab outDir = output to map refSeq to RP_ probe id used in track, use this: /cluster/data/mm7/bed/allenBrain/allProbes.tab NM_026675 RP_040914_02_A02 NM_133764 RP_050317_04_H06 /cluster/data/mm7/bed/allenBrain> head allProbes.fa >RP_040914_02_A02 TTGGAGAGCTGCCCTGTCAGACTATGGACCCCGAGGTGTCCCTGCTGCTG Assumes that sourceImageDir has .jp2 files in subdirs, but only one level deep. */ static struct optionSpec options[] = { {NULL, 0}, }; struct hash *makeImageHash(char *sourceImageDir) /* look in each subdir for .jpg files * but only look in subdirs, and only one level deep. * hash key is the gene name which is the first part of filename up to "_" * and the hash value is the relative path to the file from sourceImageDir. */ { struct hash *hash = newHash(0); struct fileInfo *dList = NULL, *dEntry; dList = listDirX(sourceImageDir, "*", FALSE); for (dEntry = dList; dEntry != NULL; dEntry = dEntry->next) { if (dEntry->isDir) { char newDir[256]; struct fileInfo *fList = NULL, *fEntry; safef(newDir,sizeof(newDir),"%s/%s",sourceImageDir,dEntry->name); fList = listDirX(newDir, "*.jpg", FALSE); for (fEntry = fList; fEntry != NULL; fEntry = fEntry->next) { char newPath[256]; char *underBar=NULL; safef(newPath,sizeof(newPath),"%s/%s",dEntry->name,fEntry->name); underBar = strchr(fEntry->name,'_'); if (underBar) { char *key = cloneStringZ(fEntry->name,underBar-fEntry->name); char *val = cloneString(newPath); hashAdd(hash, key, val); verbose(2, "imageHash key=%s value=%s\n", key, val); } } slFreeList(&fList); } } slFreeList(&dList); return hash; } struct hash *makeNameHash(char *fileName) /* Parse file in format: * name probeId * into hash keyed by probeId with name values. */ { struct hash *hash = newHash(0); struct lineFile *lf = lineFileOpen(fileName, TRUE); char *row[2]; while (lineFileRow(lf, row)) { hashAdd(hash, cloneString(row[0]), cloneString(row[1])); } lineFileClose(&lf); return hash; } void writeRa(char *fileName) /* Write our .ra file with information common to all NIBB images. */ { FILE *f = mustOpen(fileName, "w"); fprintf(f, "submitSet abaMouse1\n"); fprintf(f, "fullDir http://hgwdev.gi.ucsc.edu/visiGene/full/inSitu/Mouse/allenBrain\n"); fprintf(f, "thumbDir http://hgwdev.gi.ucsc.edu/visiGene/200/inSitu/Mouse/allenBrain\n"); fprintf(f, "itemUrl http://www.brain-map.org/search.do?queryText=%%s\n"); fprintf(f, "priority 1200\n"); fprintf(f, "sliceType sagittal\n"); fprintf(f, "submissionSource Allen Brain Atlas (ABA)\n"); fprintf(f, "taxon 10090\n"); fprintf(f, "genotype wild type\n"); fprintf(f, "strain C57BL/6\n"); fprintf(f, "age 56\n"); fprintf(f, "sex male\n"); fprintf(f, "bodyPart brain\n"); fprintf(f, "contributor Boe A.,Dang C.,Jeung D.,Luong L.,Sunkin S.,Sutram M.,Youngstrom B.,Lein E.,Jones A.,ABA ABA,ABI ABI,Allen Institute for Brain Science,Allen Brain Atlas,\n"); fprintf(f, "acknowledgement " "Thanks to the Allen Institute for Brain " "Science, particularly to Andrew Boe, Chinh Dang, Darren Jeung, Lon " "Luong, Susan Sunkin, Madhavi Sutram, and Brian Youngstrom for helping " "make these images available in VisiGene." ); /* Still need to fill in contributor, publication, journal, journalUrl */ fprintf(f, "contributor Allen Institute for Brain Science\n"); fprintf(f, "year 2006\n"); fprintf(f, "setUrl http://www.brainatlas.org/\n"); fprintf(f, "copyright © 2004-2006 Allen Institute for Brain Science\n"); fprintf(f, "probeColor blue/purple\n"); carefulClose(&f); } void writeTab( struct hash *imageHash, struct hash *seqHash, char *sourceImageDir, char *allenTab, struct hash *nameHash, char *outName) /* Synthesize data and write out tab-separated file with one line for * each image. */ { char sourceImage[PATH_LEN]; FILE *f = mustOpen(outName, "w"); struct lineFile *lf = lineFileOpen(allenTab, TRUE); char *row[5]; /* Write header. */ fprintf(f, "#"); fprintf(f, "gene\t"); fprintf(f, "refSeq\t"); fprintf(f, "locusLink\t"); fprintf(f, "submitId\t"); /* egeneid=68323 or genesym=1110003F05Rik */ fprintf(f, "fileName\t"); fprintf(f, "imageWidth\t"); fprintf(f, "imageHeight\t"); fprintf(f, "probeId\t"); /* actually, this not supported yet but would be great. */ fprintf(f, "seq\n"); while (lineFileRowTab(lf, row)) { char *gene = row[0]; /* char *geneName = row[1]; */ char *entrez = row[2]; char *refSeq = row[3]; char *url = row[4]; char *probeId = hashFindVal(nameHash, refSeq); struct dnaSeq *seq = NULL; int width=0, height=0; char *relPath = hashFindVal(imageHash, gene); char *submitId = strchr(url,'='); if (probeId) seq = hashFindVal(seqHash, probeId); if (submitId) ++submitId; /* we want the string following first '=' */ if (sameString(entrez,"0")) entrez = NULL; if (relPath) { safef(sourceImage, sizeof(sourceImage), "%s/%s", sourceImageDir, relPath); jpegSize(sourceImage, &width, &height); fprintf(f, "%s\t", gene); fprintf(f, "%s\t", refSeq); fprintf(f, "%s\t", entrez?entrez:""); fprintf(f, "%s\t", submitId); fprintf(f, "%s\t", relPath); fprintf(f, "%d\t", width); fprintf(f, "%d\t", height); fprintf(f, "%s\t", probeId?probeId:""); if (seq != NULL) fprintf(f, "%s\n", seq->dna); else fprintf(f, "\n"); } } lineFileClose(&lf); carefulClose(&f); } void vgLoadAllen(char *sourceImageDir, char *allenTab, char *probesFa, char *nameTab, char *outDir) /* vgLoadAllen - Create .ra and .tab files for loading Xenopus images from NIBB * into VisiGene. */ { struct hash *imageHash = makeImageHash(sourceImageDir); struct hash *nameHash = makeNameHash(nameTab); struct hash *seqHash = dnaSeqHash(faReadAllDna(probesFa)); char outPath[PATH_LEN]; verbose(1, "Got %d images\n", imageHash->elCount); verbose(1, "Got %d named probes\n", nameHash->elCount); verbose(1, "Got %d probe sequences\n", seqHash->elCount); /* Make output directory and ra file. */ makeDir(outDir); safef(outPath, sizeof(outPath), "%s/%s", outDir, "aba.ra"); writeRa(outPath); /* Make tab separated file. */ safef(outPath, sizeof(outPath), "%s/%s", outDir, "aba.tab"); writeTab(imageHash, seqHash, sourceImageDir, allenTab, nameHash, outPath); } int main(int argc, char *argv[]) /* Process command line. */ { optionInit(&argc, argv, options); if (argc != 6) usage(); vgLoadAllen(argv[1], argv[2], argv[3], argv[4], argv[5]); return 0; }