4898794edd81be5285ea6e544acbedeaeb31bf78 max Tue Nov 23 08:10:57 2021 -0800 Fixing pointers to README file for license in all source code files. refs #27614 diff --git src/hg/visiGene/vgProbeTrack/vgProbeTrack.c src/hg/visiGene/vgProbeTrack/vgProbeTrack.c index d7d0d1c..bba913a 100644 --- src/hg/visiGene/vgProbeTrack/vgProbeTrack.c +++ src/hg/visiGene/vgProbeTrack/vgProbeTrack.c @@ -1,1677 +1,1677 @@ /* Copyright (C) 2013 The Regents of the University of California - * See README in this or parent directory for licensing information. */ + * See kent/LICENSE or http://genome.ucsc.edu/license/ for licensing information. */ /* vgProbeTrack - build vgPrb% permanent id tables in visiGene database, * also updates $db.vg{All}Probes tables * * This finds sequence for all probes, using the best method available, * which can be given in probe.seq, using the primers to * fetch the probe using isPcr, or using accession or gene to fetch sequence. * * When all the sequences are availabe and ready, then blat is run to * create psl alignments for use in probe tracks which may also be * mapped over to human orthologous position using either chains with pslMap (mouse) * or blatz (frog). * */ #include "common.h" #include "linefile.h" #include "hash.h" #include "options.h" #include "obscure.h" #include "ra.h" #include "jksql.h" #include "dystring.h" #include "portable.h" #include "fa.h" #include "hdb.h" #include "vgPrb.h" /* Variables you can override from command line. */ char *database = "visiGene"; char *sqlPath = "."; void usage() /* Explain usage and exit. */ { errAbort( "vgProbeTrack - build permanent-Id vgPrb* tables in visiGene database\n" " and update assembly-specific tables vgProbes and vgAllProbes\n" "usage:\n" " vgProbeTrack <COMMAND> {workingDir db} {optional params}\n" "\n" "Commands:\n" " INIT - WARNING! drops and creates all tables (except vgPrb is not dropped). \n" " POP - populate vgPrb to catch probes for newly added submission sets. \n" " SEQ workingDir db - find sequence using assembly db. \n" " ALI workingDir db - find or blat any needed alignments for vgProbes track. \n" " EXT workingDir db - add any needed seq and extfile records for vgProbes track. \n" " PSLMAP workingDir db fromDb - pslMap using chains fromDb to db for vgAllProbes track. \n" " REMAP workingDir db fromDb track fa - import db.track psls of fromDb using fa fasta file for vgAllProbes track. \n" " SELFMAP workingDir db - migrate self vgProbes to vgAllProbes track. \n" " EXTALL workingDir db - add any needed seq and extfile records for vgAllProbes track. \n" "\n" "workingDir is a directory with space for intermediate and final results.\n" "db is the target assembly to use.\n" "Options:\n" " -database=%s - Specifically set database (default visiGene)\n" " -sqlPath=%s - specify location of vgPrb.sql, relative to workingDir \n" , database, sqlPath ); } static struct optionSpec options[] = { {"database", OPTION_STRING,}, {"sqlPath", OPTION_STRING,}, {NULL, 0}, }; /* --- defining just the fields needed from bac ---- */ struct bac /* Information from bac */ { struct bac *next; /* Next in singly linked list. */ char *chrom; /* chrom */ int chromStart; /* start */ int chromEnd; /* end */ char *strand; /* strand */ int probe; /* probe */ }; struct bac *bacLoad(char **row) /* Load a bac from row fetched with select * from bac * from database. Dispose of this with bacFree(). */ { struct bac *ret; AllocVar(ret); ret->chrom = cloneString(row[0]); ret->chromStart = atoi(row[1]); ret->chromEnd = atoi(row[2]); ret->strand = cloneString(row[3]); ret->probe = atoi(row[4]); return ret; } void bacFree(struct bac **pEl) /* Free a single dynamically allocated bac such as created * with bacLoad(). */ { struct bac *el; if ((el = *pEl) == NULL) return; freeMem(el->chrom); freeMem(el->strand); freez(pEl); } void bacFreeList(struct bac **pList) /* Free a list of dynamically allocated bac's */ { struct bac *el, *next; for (el = *pList; el != NULL; el = next) { next = el->next; bacFree(&el); } *pList = NULL; } struct bac *bacRead(struct sqlConnection *conn, int taxon, char *db) /* Slurp in the bac rows sorted by chrom */ { struct bac *list=NULL, *el; char query[512]; struct sqlResult *sr; char **row; sqlSafef(query, sizeof(query), "select e.chrom, e.chromStart, e.chromEnd, e.strand, pe.id" " from probe p, vgPrbMap m, vgPrb pe, bac b, %s.bacEndPairs e" " where p.bac = b.id and p.id = m.probe and pe.id = m.vgPrb" " and pe.taxon=%d and b.name = e.name" " and pe.type='bac' and pe.state='new'" " order by e.chrom, e.chromStart", db,taxon); sr = sqlGetResult(conn, query); while ((row = sqlNextRow(sr)) != NULL) { el = bacLoad(row); slAddHead(&list,el); } sqlFreeResult(&sr); slReverse(&list); return list; } char *checkAndFetchBacDna(struct dnaSeq *chromSeq, struct bac *bac) /* fetch bac dna return string to be freed later. Reports if segment exceeds ends of chromosome. */ { if (bac->chromStart < 0) { errAbort("bac error chromStart < 0 : %s %u %u %s %d \n", bac->chrom, bac->chromStart, bac->chromEnd, bac->strand, bac->probe ); return NULL; } if (bac->chromEnd > chromSeq->size) { errAbort("bac error chromEnd > chromSeq->size (%lu) : %s %u %u %s %d \n", (unsigned long) chromSeq->size, bac->chrom, bac->chromStart, bac->chromEnd, bac->strand, bac->probe ); return NULL; } return cloneStringZ(chromSeq->dna + bac->chromStart, bac->chromEnd - bac->chromStart); } static int findVgPrbBySeq(struct sqlConnection *conn, char *seq, int taxon) /* find vgPrb.id by seq given or return 0 if not found */ { char *fmt = "select id from vgPrb where seq = '%s' and taxon=%d"; int size = strlen(fmt)+strlen(seq)+4; char *sql = needMem(size); sqlSafef(sql,size,fmt,seq,taxon); return sqlQuickNum(conn,sql); freez(&sql); } static void populateMissingVgPrb(struct sqlConnection *conn) /* populate vgPrb where missing, usually after new records added to visiGene */ { struct sqlResult *sr; char **row; struct dyString *dy = dyStringNew(0); struct sqlConnection *conn2 = sqlConnect(database); struct sqlConnection *conn3 = sqlConnect(database); int probeCount=0, vgPrbCount=0; sqlDyStringPrintf(dy, "select p.id,p.gene,antibody,probeType,fPrimer,rPrimer,p.seq,bac,g.taxon" " from probe p join gene g" " left join vgPrbMap m on m.probe = p.id" " where g.id = p.gene" " and m.probe is NULL"); sr = sqlGetResult(conn, dy->string); while ((row = sqlNextRow(sr)) != NULL) { int id = sqlUnsigned(row[0]); /* int gene = sqlUnsigned(row[1]); */ /* int antibody = sqlUnsigned(row[2]); */ /* int probeType = sqlUnsigned(row[3]); */ char *fPrimer = row[4]; char *rPrimer = row[5]; char *seq = row[6]; int bac = sqlUnsigned(row[7]); int taxon = sqlUnsigned(row[8]); char *peType = "none"; int peProbe = id; char *peSeq = seq; char *tName = ""; int tStart = 0; int tEnd = 0; char *tStrand = " "; /* char *peGene = ""; int bacInfo = 0; int seqid = 0; int pslid = 0; */ char *state = "new"; char *db = ""; int vgPrb = 0; if (isNotEmpty(seq)) { peType = "probe"; state = "seq"; } else if (isNotEmpty(fPrimer) && isNotEmpty(rPrimer)) { peType = "primersMrna"; } else if (isNotEmpty(fPrimer) && isEmpty(rPrimer)) { /* only have fPrimer, it's probably a comment, not dna seq */ peType = "refSeq"; /* use accession or gene */ } else if (bac > 0) { peType = "bac"; /* use bacEndPairs */ } else { peType = "refSeq"; /* use accession or gene */ } if (!sameString(peSeq,"")) { vgPrb = findVgPrbBySeq(conn3,peSeq,taxon); } if (vgPrb == 0) { dyStringClear(dy); sqlDyStringPrintf(dy, "insert into vgPrb set"); sqlDyStringPrintf(dy, " id=default,\n"); sqlDyStringPrintf(dy, " type='%s',\n", peType); sqlDyStringPrintf(dy, " seq='%s'\n", peSeq); sqlDyStringPrintf(dy, " tName='%s',\n", tName); sqlDyStringPrintf(dy, " tStart=%d,\n", tStart); sqlDyStringPrintf(dy, " tEnd=%d,\n", tEnd); sqlDyStringPrintf(dy, " tStrand='%s',\n", tStrand); sqlDyStringPrintf(dy, " db='%s',\n", db); sqlDyStringPrintf(dy, " taxon='%d',\n", taxon); sqlDyStringPrintf(dy, " state='%s'\n", state); verbose(2, "%s\n", dy->string); sqlUpdate(conn2, dy->string); vgPrb = sqlLastAutoId(conn2); vgPrbCount++; } dyStringClear(dy); sqlDyStringPrintf(dy, "insert into vgPrbMap set"); sqlDyStringPrintf(dy, " probe=%d,\n", peProbe); sqlDyStringPrintf(dy, " vgPrb=%d \n", vgPrb); verbose(2, "%s\n", dy->string); sqlUpdate(conn2, dy->string); probeCount++; } verbose(1, "# new probe records found = %d, # new vgPrb records added = %d\n", probeCount, vgPrbCount); dyStringFree(&dy); sqlFreeResult(&sr); sqlDisconnect(&conn3); sqlDisconnect(&conn2); } static void processIsPcr(struct sqlConnection *conn, int taxon, char *db) /* process isPcr results */ { /* >NM_010919:371+1088 2 718bp CGCGGATCCAAGGACATCTTGGACCTTCCG CCCAAGCTTGCATGTGCTGCAGCGACTGCG */ struct dyString *dy = dyStringNew(0); struct lineFile *lf = lineFileOpen("isPcr.fa", TRUE); int lineSize; char *line; char *name; char *dna; char *word, *end; char *tName; int tStart; int tEnd; char *tStrand; int probeid=0; /* really a vgPrb id */ boolean more = lineFileNext(lf, &line, &lineSize); while(more) { if (line[0] != '>') errAbort("unexpected error out of phase\n"); name = cloneString(line); verbose(1,"name=%s\n",name); dyStringClear(dy); while((more=lineFileNext(lf, &line, &lineSize))) { if (line[0] == '>') { break; } dyStringAppend(dy,line); } dna = cloneString(dy->string); word = name+1; end = strchr(word,':'); tName = cloneStringZ(word,end-word); word = end+1; end = strchr(word,'+'); tStrand = "+"; if (!end) { end = strchr(word,'-'); tStrand = "-"; } tStart = atoi(word); word = end+1; end = strchr(word,' '); tEnd = atoi(word); word = end+1; end = strchr(word,' '); probeid = atoi(word); dyStringClear(dy); sqlDyStringPrintf(dy, "select count(*) from vgPrb where id=%d and state='new'",probeid); if (sqlQuickNum(conn,dy->string)>0) { /* record exists and hasn't already been updated */ int vgPrb = findVgPrbBySeq(conn,dna,taxon); if (vgPrb == 0) { dyStringClear(dy); sqlDyStringPrintf(dy, "update vgPrb set"); sqlDyStringPrintf(dy, " seq='%s'\n", dna); sqlDyStringPrintf(dy, " tName='%s',\n", tName); sqlDyStringPrintf(dy, " tStart=%d,\n", tStart); sqlDyStringPrintf(dy, " tEnd=%d,\n", tEnd); sqlDyStringPrintf(dy, " tStrand='%s',\n", tStrand); sqlDyStringPrintf(dy, " db='%s',\n", db); sqlDyStringPrintf(dy, " state='%s'\n", "seq"); sqlDyStringPrintf(dy, " where id=%d\n", probeid); sqlDyStringPrintf(dy, " and state='%s'\n", "new"); verbose(2, "%s\n", dy->string); sqlUpdate(conn, dy->string); } else /* probe seq already exists */ { /* just re-map the probe table recs to it */ dyStringClear(dy); sqlDyStringPrintf(dy, "update vgPrbMap set vgPrb=%d where vgPrb=%d",vgPrb,probeid); sqlUpdate(conn, dy->string); /* and delete it from vgPrb */ dyStringClear(dy); sqlDyStringPrintf(dy, "delete from vgPrb where id=%d",probeid); sqlUpdate(conn, dy->string); } } freez(&tName); freez(&name); freez(&dna); } lineFileClose(&lf); dyStringFree(&dy); } static int doBacs(struct sqlConnection *conn, int taxon, char *db) /* fetch available sequence for bacEndPairs */ { struct dyString *dy = dyStringNew(0); struct dnaSeq *chromSeq = NULL; struct bac *bacs = bacRead(conn, taxon, db); struct bac *bac = NULL; char *chrom = cloneString(""); int count = 0; verbose(1,"bac list read done.\n"); for(bac=bacs;bac;bac=bac->next) { if (differentWord(chrom,bac->chrom)) { verbose(1,"switching to chrom %s\n",bac->chrom); dnaSeqFree(&chromSeq); chromSeq = hLoadChrom(bac->chrom,db); freez(&chrom); chrom = cloneString(bac->chrom); } char *dna = checkAndFetchBacDna(chromSeq, bac); if (sameString(bac->strand,"-")) { reverseComplement(dna,strlen(dna)); } dyStringClear(dy); sqlDyStringPrintf(dy, "select count(*) from vgPrb where id=%d and state='new'",bac->probe); if (sqlQuickNum(conn,dy->string)>0) { /* record exists and hasn't already been updated */ int vgPrb = findVgPrbBySeq(conn,dna,taxon); if (vgPrb == 0) { dyStringClear(dy); sqlDyStringPrintf(dy, "update vgPrb set"); sqlDyStringPrintf(dy, " seq='%s'\n", dna); sqlDyStringPrintf(dy, " tName='%s',\n", bac->chrom); sqlDyStringPrintf(dy, " tStart=%d,\n", bac->chromStart); sqlDyStringPrintf(dy, " tEnd=%d,\n", bac->chromEnd); sqlDyStringPrintf(dy, " tStrand='%s',\n", bac->strand); sqlDyStringPrintf(dy, " db='%s',\n", db); sqlDyStringPrintf(dy, " state='%s'\n", "seq"); sqlDyStringPrintf(dy, " where id=%d\n", bac->probe); sqlDyStringPrintf(dy, " and state='%s'\n", "new"); //verbose(2, "%s\n", dy->string); // the sql string could be quite large sqlUpdate(conn, dy->string); } else /* probe seq already exists */ { /* just re-map the probe table recs to it */ dyStringClear(dy); sqlDyStringPrintf(dy, "update vgPrbMap set vgPrb=%d where vgPrb=%d",vgPrb,bac->probe); sqlUpdate(conn, dy->string); /* and delete it from vgPrb */ dyStringClear(dy); sqlDyStringPrintf(dy, "delete from vgPrb where id=%d",bac->probe); sqlUpdate(conn, dy->string); } ++count; verbose(2,"%d finished bac for probe id %d size %d\n", count, bac->probe, bac->chromEnd - bac->chromStart); } freez(&dna); } freez(&chrom); dnaSeqFree(&chromSeq); bacFreeList(&bacs); dyStringFree(&dy); return count; } static void doPrimers(struct sqlConnection *conn, int taxon, char *db) /* get probe seq from primers */ { int rc = 0; struct dyString *dy = dyStringNew(0); char cmdLine[256]; char path1[256]; char path2[256]; dyStringClear(dy); sqlDyStringPrintf(dy, "select e.id, p.fPrimer, p.rPrimer from probe p, vgPrbMap m, vgPrb e, gene g"); sqlDyStringPrintf(dy, " where p.id = m.probe and m.vgPrb = e.id and g.id = p.gene and g.taxon = %d",taxon); sqlDyStringPrintf(dy, " and e.state = 'new' and e.type='primersMrna'"); rc = sqlSaveQuery(conn, dy->string, "primers.query", FALSE); verbose(1,"rc = %d = count of primers for mrna search for taxon %d\n",rc,taxon); if (rc > 0) /* something to do */ { dyStringClear(dy); sqlDyStringPrintf(dy, "select qName from %s.all_mrna",db); rc = 0; rc = sqlSaveQuery(conn, dy->string, "accFile.txt", FALSE); safef(cmdLine,sizeof(cmdLine),"getRna %s accFile.txt mrna.fa",db); system("date"); verbose(1,"cmdLine: [%s]\n",cmdLine); system(cmdLine); system("date"); verbose(1,"rc = %d = count of mrna for %s\n",rc,db); system("date"); system("isPcr mrna.fa primers.query isPcr.fa -out=fa"); system("date"); system("ls -l"); processIsPcr(conn,taxon,db); unlink("mrna.fa"); unlink("accFile.txt"); unlink("isPcr.fa"); } unlink("primers.query"); /* find any remaining type primersMrna that couldn't be resolved and demote * them to type primersGenome */ dyStringClear(dy); sqlDyStringPrintf(dy, "update vgPrb set type='primersGenome'"); sqlDyStringPrintf(dy, " where taxon = %d",taxon); sqlDyStringPrintf(dy, " and state = 'new' and type='primersMrna'"); sqlUpdate(conn, dy->string); /* get primers for those probes that did not find mrna isPcr matches * and then do them against the genome instead */ dyStringClear(dy); sqlDyStringPrintf(dy, "select e.id, p.fPrimer, p.rPrimer from probe p, vgPrbMap m, vgPrb e, gene g"); sqlDyStringPrintf(dy, " where p.id = m.probe and m.vgPrb = e.id and g.id = p.gene and g.taxon = %d",taxon); sqlDyStringPrintf(dy, " and e.state = 'new' and e.type='primersGenome'"); rc = 0; rc = sqlSaveQuery(conn, dy->string, "primers.query", FALSE); verbose(1,"rc = %d = count of primers for genome search for taxon %d\n",rc,taxon); if (rc > 0) /* something to do */ { safef(path1,sizeof(path1),"/gbdb/%s/%s.2bit",db,db); safef(path2,sizeof(path2),"%s/%s.2bit",getCurrentDir(),db); verbose(1,"copy: [%s] to [%s]\n",path1,path2); copyFile(path1,path2); safef(cmdLine,sizeof(cmdLine), "ssh kolossus 'cd %s; isPcr %s.2bit primers.query isPcr.fa -out=fa'", getCurrentDir(),db); system("date"); verbose(1,"cmdLine: [%s]\n",cmdLine); system(cmdLine); system("date"); safef(path2,sizeof(path2),"%s/%s.2bit",getCurrentDir(),db); verbose(1,"rm %s\n",path2); unlink(path2); system("ls -l"); processIsPcr(conn,taxon,db); unlink("mrna.fa"); unlink("accFile.txt"); unlink("isPcr.fa"); } unlink("primers.query"); /* find any remaining type primersGenome that couldn't be resolved and demote * them to type refSeq */ dyStringClear(dy); sqlDyStringPrintf(dy, "update vgPrb set type='refSeq'"); sqlDyStringPrintf(dy, " where taxon = %d",taxon); sqlDyStringPrintf(dy, " and state = 'new' and type='primersGenome'"); sqlUpdate(conn, dy->string); dyStringFree(&dy); } static void doBacEndPairs(struct sqlConnection *conn, int taxon, char *db) /* get probe seq bacEndPairs */ { struct dyString *dy = dyStringNew(0); int rc = 0; /* fetch available sequence for bacEndPairs */ rc = doBacs(conn, taxon, db); verbose(1,"found seq for %d bacEndPairs\n",rc); /* find any remaining type bac that couldn't be resolved and demote * them to type refSeq */ dyStringClear(dy); sqlDyStringPrintf(dy, "update vgPrb set type='refSeq'"); sqlDyStringPrintf(dy, " where taxon = %d",taxon); sqlDyStringPrintf(dy, " and state = 'new' and type='bac'"); sqlUpdate(conn, dy->string); dyStringFree(&dy); } static void setTName(struct sqlConnection *conn, int taxon, char *db, char *type, char *fld) /* set vgPrb.tName to the desired value to try, * e.g. gene.refSeq, gene.genbank, mm6.refFlat.name(genoName=gene.name). */ { struct dyString *dy = dyStringNew(0); dyStringClear(dy); sqlDyStringPrintf(dy, "update vgPrb e, vgPrbMap m, probe p, gene g" " set e.seq = '', e.tName = g.%s" " where e.id = m.vgPrb and m.probe = p.id and p.gene = g.id" " and e.type = '%s'" " and e.state = 'new'" " and e.taxon = %d" , fld, type, taxon); sqlUpdate(conn, dy->string); dyStringFree(&dy); } static void setTNameMapped(struct sqlConnection *conn, int taxon, char *db, char *type, char *fld, char *mapTable, char *mapField, char *mapTo) /* set vgPrb.tName to the desired value to try, * e.g. gene.refSeq, gene.genbank, mm6.refFlat.name(genoName=gene.name). */ { struct dyString *dy = dyStringNew(0); dyStringClear(dy); sqlDyStringPrintf(dy, "update vgPrb e, vgPrbMap m, probe p, gene g, %s.%s f" " set e.seq = '', e.tName = f.%s" " where e.id = m.vgPrb and m.probe = p.id and p.gene = g.id" " and g.%s = f.%s" " and e.type = '%s'" " and e.state = 'new'" " and g.taxon = %d" ,db, mapTable, mapTo, fld, mapField, type, taxon); sqlUpdate(conn, dy->string); dyStringFree(&dy); } static void processMrnaFa(struct sqlConnection *conn, int taxon, char *type, char *db) /* process isPcr results */ { struct dyString *dy = dyStringNew(0); struct lineFile *lf = lineFileOpen("mrna.fa", TRUE); int lineSize; char *line; char *name; char *dna; boolean more = lineFileNext(lf, &line, &lineSize); while(more) { if (line[0] != '>') errAbort("unexpected error out of phase\n"); name = cloneString(line+1); verbose(2,"name=%s\n",name); dyStringClear(dy); while((more=lineFileNext(lf, &line, &lineSize))) { if (line[0] == '>') { break; } dyStringAppend(dy,line); } dna = cloneString(dy->string); while(1) { int oldProbe = 0; dyStringClear(dy); sqlDyStringPrintf(dy, "select id from vgPrb " "where taxon=%d and type='%s' and tName='%s' and state='new'",taxon,type,name); oldProbe = sqlQuickNum(conn,dy->string); if (oldProbe==0) break; /* no more records match */ /* record exists and hasn't already been updated */ int vgPrb = findVgPrbBySeq(conn,dna,taxon); if (vgPrb == 0) { dyStringClear(dy); sqlDyStringPrintf(dy, "update vgPrb set"); sqlDyStringPrintf(dy, " seq = '%s'\n", dna); sqlDyStringPrintf(dy, " db = '%s',\n", db); sqlDyStringPrintf(dy, " state = 'seq'\n"); sqlDyStringPrintf(dy, " where id=%d\n", oldProbe); sqlDyStringPrintf(dy, " and state='%s'\n", "new"); verbose(2, "%s\n", dy->string); sqlUpdate(conn, dy->string); } else /* probe seq already exists */ { /* just re-map the probe table recs to it */ dyStringClear(dy); sqlDyStringPrintf(dy, "update vgPrbMap set vgPrb=%d where vgPrb=%d",vgPrb,oldProbe); sqlUpdate(conn, dy->string); /* and delete it from vgPrb */ dyStringClear(dy); sqlDyStringPrintf(dy, "delete from vgPrb where id=%d",oldProbe); sqlUpdate(conn, dy->string); } } freez(&name); freez(&dna); } lineFileClose(&lf); dyStringFree(&dy); } static int getAccMrnas(struct sqlConnection *conn, int taxon, char *db, char *type, char *table) /* get mRNAs for one vgPrb acc type */ { int rc = 0; struct dyString *dy = dyStringNew(0); char cmdLine[256]; dyStringClear(dy); sqlDyStringPrintf(dy, "select distinct e.tName from vgPrb e, %s.%s m" " where e.tName = m.qName" " and e.taxon = %d and e.type = '%s' and e.tName <> '' and e.state = 'new'" ,db,table,taxon,type); rc = 0; rc = sqlSaveQuery(conn, dy->string, "accFile.txt", FALSE); safef(cmdLine,sizeof(cmdLine),"getRna %s accFile.txt mrna.fa",db); //system("date"); verbose(1,"cmdLine: [%s]\n",cmdLine); system(cmdLine); //system("date"); processMrnaFa(conn, taxon, type, db); unlink("mrna.fa"); unlink("accFile.txt"); dyStringFree(&dy); return rc; } static void advanceType(struct sqlConnection *conn, int taxon, char *oldType, char *newType) /* find any remaining type refSeq that couldn't be resolved and demote * them to type genbank */ { struct dyString *dy = dyStringNew(0); dyStringClear(dy); sqlDyStringPrintf(dy, "update vgPrb set type='%s', tName=''" " where taxon = %d and state = 'new' and type='%s'" ,newType,taxon,oldType); sqlUpdate(conn, dy->string); dyStringFree(&dy); } static void doAccessionsSeq(struct sqlConnection *conn, int taxon, char *db) /* get probe seq from Accessions */ { int rc = 0; struct dyString *dy = dyStringNew(0); /* get refSeq accessions and rna */ setTName(conn, taxon, db, "refSeq", "refSeq"); rc = getAccMrnas(conn, taxon, db, "refSeq", "refSeqAli"); verbose(1,"rc = %d = count of refSeq mrna for %s\n",rc,db); advanceType(conn,taxon,"refSeq","genRef"); /* get refSeq-in-gene.genbank accessions and rna */ setTName(conn, taxon, db, "genRef", "genbank"); rc = getAccMrnas(conn, taxon, db, "genRef", "refSeqAli"); verbose(1,"rc = %d = count of genRef mrna for %s\n",rc,db); advanceType(conn,taxon,"genRef","genbank"); /* get genbank accessions and rna */ setTName(conn, taxon, db, "genbank", "genbank"); rc = getAccMrnas(conn, taxon, db, "genbank", "all_mrna"); verbose(1,"rc = %d = count of genbank mrna for %s\n",rc,db); advanceType(conn,taxon,"genbank","flatRef"); /* get gene.name -> refFlat to refSeq accessions and rna */ setTNameMapped(conn, taxon, db, "flatRef", "name", "refFlat", "geneName", "name"); rc = getAccMrnas(conn, taxon, db, "flatRef", "refSeqAli"); verbose(1,"rc = %d = count of flatRef mrna for %s\n",rc,db); advanceType(conn,taxon,"flatRef","flatAll"); /* get gene.name -> refFlat to all_mrna accessions */ setTNameMapped(conn, taxon, db, "flatAll", "name", "refFlat", "geneName", "name"); rc = getAccMrnas(conn, taxon, db, "flatAll", "all_mrna"); verbose(1,"rc = %d = count of flatAll mrna for %s\n",rc,db); advanceType(conn,taxon,"flatAll","linkRef"); /* get gene.name -> refLink to refSeq accessions and rna */ setTNameMapped(conn, taxon, db, "linkRef", "name", "refLink", "name", "mrnaAcc"); rc = getAccMrnas(conn, taxon, db, "linkRef", "refSeqAli"); verbose(1,"rc = %d = count of linkRef mrna for %s\n",rc,db); advanceType(conn,taxon,"linkRef","linkAll"); /* get gene.name -> refLink to all_mrna accessions */ setTNameMapped(conn, taxon, db, "linkAll", "name", "refLink", "name", "mrnaAcc"); rc = getAccMrnas(conn, taxon, db, "linkAll", "all_mrna"); verbose(1,"rc = %d = count of linkAll mrna for %s\n",rc,db); advanceType(conn,taxon,"linkAll","kgAlRef"); /* get gene.name -> kgAlias to refSeq accessions and rna */ setTNameMapped(conn, taxon, db, "kgAlRef", "name", "kgAlias", "alias", "kgId"); rc = getAccMrnas(conn, taxon, db, "kgAlRef", "refSeqAli"); verbose(1,"rc = %d = count of kgAlRef mrna for %s\n",rc,db); advanceType(conn,taxon,"kgAlRef","kgAlAll"); /* get gene.name -> kgAlias to all_mrna accessions */ setTNameMapped(conn, taxon, db, "kgAlAll", "name", "kgAlias", "alias", "kgId"); rc = getAccMrnas(conn, taxon, db, "kgAlAll", "all_mrna"); verbose(1,"rc = %d = count of kgAlAll mrna for %s\n",rc,db); advanceType(conn,taxon,"kgAlAll","gene"); dyStringFree(&dy); } static void initTable(struct sqlConnection *conn, char *table, boolean nuke) /* build tables */ { char *sql = NULL; char path[256]; if (nuke) sqlDropTable(conn, table); if (!sqlTableExists(conn, table)) { safef(path,sizeof(path),"%s/%s.sql",sqlPath,table); readInGulp(path, &sql, NULL); sqlUpdate(conn, sql); } } static void populateMissingVgPrbAli(struct sqlConnection *conn, int taxon, char *db, char *table) /* populate vgPrbAli for db */ { struct dyString *dy = dyStringNew(0); dyStringClear(dy); sqlDyStringPrintf(dy, "insert into %s" " select distinct '%s', e.id, 'new' from vgPrb e" " left join %s a on e.id = a.vgPrb and a.db = '%s'" " where a.vgPrb is NULL " " and e.taxon = %d" ,table,db,table,db,taxon); sqlUpdate(conn, dy->string); dyStringFree(&dy); } static void updateVgPrbAli(struct sqlConnection *conn, char *db, char *table, char *track) /* update vgPrbAli from vgProbes track for db */ { struct dyString *dy = dyStringNew(0); char dbTrk[256]; safef(dbTrk,sizeof(dbTrk),"%s.%s",db,track); if (!sqlTableExists(conn, dbTrk)) { struct sqlConnection *conn2 = sqlConnect(db); verbose(1,"FYI: Table %s does not exist\n",dbTrk); initTable(conn2, track, FALSE); sqlDisconnect(&conn2); } dyStringClear(dy); sqlDyStringPrintf(dy, "update %s a, %s.%s v" " set a.status = 'ali'" " where v.qName = concat('vgPrb_',a.vgPrb)" " and a.db = '%s'" ,table,db,track,db); sqlUpdate(conn, dy->string); dyStringFree(&dy); } static void markNoneVgPrbAli(struct sqlConnection *conn, int fromTaxon, char *db, char *table) /* mark records in vgPrbAli that did not find any alignment for db */ { struct dyString *dy = dyStringNew(0); dyStringClear(dy); sqlDyStringPrintf(dy, "update %s a, vgPrb e" " set a.status = 'none'" " where a.status = 'new'" " and a.db = '%s' and e.taxon = %d" " and a.vgPrb = e.id" ,table,db,fromTaxon); sqlUpdate(conn, dy->string); dyStringFree(&dy); } static int doAccPsls(struct sqlConnection *conn, int taxon, char *db, char *type, char *table) /* get psls for one vgPrb acc type */ { int rc = 0; struct dyString *dy = dyStringNew(0); char outName[256]; dyStringClear(dy); sqlDyStringPrintf(dy, "select m.matches,m.misMatches,m.repMatches,m.nCount,m.qNumInsert,m.qBaseInsert," "m.tNumInsert,m.tBaseInsert,m.strand," "concat(\"vgPrb_\",e.id)," "m.qSize,m.qStart,m.qEnd,m.tName,m.tSize,m.tStart,m.tEnd,m.blockCount," "m.blockSizes,m.qStarts,m.tStarts" " from vgPrb e, vgPrbAli a, %s.%s m" " where e.id = a.vgPrb and a.db = '%s' and a.status='new' and e.tName = m.qName" " and e.taxon = %d and e.type = '%s' and e.tName <> '' and e.state='seq' and e.seq <> ''" " order by m.tName,m.tStart" ,db,table,db,taxon,type); rc = 0; safef(outName,sizeof(outName),"%s.psl",type); rc = sqlSaveQuery(conn, dy->string, outName, FALSE); dyStringFree(&dy); return rc; } static int dumpPslTable(struct sqlConnection *conn, char *db, char *table) /* dump psls for db.table to table.psl in current (working) dir */ { int rc = 0; struct dyString *dy = dyStringNew(0); char outName[256]; dyStringClear(dy); sqlDyStringPrintf(dy, "select matches,misMatches,repMatches,nCount,qNumInsert,qBaseInsert," "tNumInsert,tBaseInsert,strand," "qName,qSize,qStart,qEnd,tName,tSize,tStart,tEnd," "blockCount,blockSizes,qStarts,tStarts" " from %s.%s" " order by tName,tStart" ,db,table); rc = 0; safef(outName,sizeof(outName),"%s.psl",table); rc = sqlSaveQuery(conn, dy->string, outName, FALSE); dyStringFree(&dy); return rc; } static void doAccessionsAli(struct sqlConnection *conn, int taxon, char *db) /* get probe alignments from Accessions */ { int rc = 0; /* get refSeq psls */ rc = doAccPsls(conn, taxon, db, "refSeq", "refSeqAli"); verbose(1,"rc = %d = count of refSeq psls for %s\n",rc,db); /* get genRef psls */ rc = doAccPsls(conn, taxon, db, "genRef", "refSeqAli"); verbose(1,"rc = %d = count of genRef psls for %s\n",rc,db); /* get genbank psls */ rc = doAccPsls(conn, taxon, db, "genbank", "all_mrna"); verbose(1,"rc = %d = count of genbank psls for %s\n",rc,db); /* get flatRef psls */ rc = doAccPsls(conn, taxon, db, "flatRef", "refSeqAli"); verbose(1,"rc = %d = count of flatRef psls for %s\n",rc,db); /* get flatAll psls */ rc = doAccPsls(conn, taxon, db, "flatAll", "all_mrna"); verbose(1,"rc = %d = count of flatAll psls for %s\n",rc,db); /* get linkRef psls */ rc = doAccPsls(conn, taxon, db, "linkRef", "refSeqAli"); verbose(1,"rc = %d = count of linkRef psls for %s\n",rc,db); /* get linkAll psls */ rc = doAccPsls(conn, taxon, db, "linkAll", "all_mrna"); verbose(1,"rc = %d = count of linkAll psls for %s\n",rc,db); /* get kgAlRef psls */ rc = doAccPsls(conn, taxon, db, "kgAlRef", "refSeqAli"); verbose(1,"rc = %d = count of kgAlRef psls for %s\n",rc,db); /* get kgAlAll psls */ rc = doAccPsls(conn, taxon, db, "kgAlAll", "all_mrna"); verbose(1,"rc = %d = count of kgAlRef psls for %s\n",rc,db); } static void doFakeBacAli(struct sqlConnection *conn, int taxon, char *db) /* place probe seq from primers, etc with blat */ { int rc = 0; struct dyString *dy = dyStringNew(0); /* create fake psls as blatBAC.psl */ dyStringClear(dy); sqlDyStringPrintf(dy, "select length(e.seq), 0, 0, 0, 0, 0, 0, 0, e.tStrand, concat('vgPrb_',e.id), length(e.seq)," " 0, length(e.seq), e.tName, ci.size, e.tStart, e.tEnd, 1," " concat(length(e.seq),','), concat(0,','), concat(e.tStart,',')" " from vgPrb e, %s.chromInfo ci, vgPrbAli a" " where ci.chrom = e.tName and e.id = a.vgPrb" " and e.type = 'bac'" " and e.taxon = %d" " and a.db = '%s' and a.status='new'" , db, taxon, db); //restore: rc = sqlSaveQuery(conn, dy->string, "fakeBAC.psl", FALSE); verbose(1,"rc = %d = count of sequences for fakeBAC.psl, for taxon %d\n",rc,taxon); dyStringFree(&dy); } static void doBlat(struct sqlConnection *conn, int taxon, char *db) /* place probe seq from non-BAC with blat that have no alignments yet */ { int rc = 0; char *blatSpec=NULL; char cmdLine[256]; char path1[256]; char path2[256]; struct dyString *dy = dyStringNew(0); /* (non-BACs needing alignment) */ dyStringClear(dy); sqlDyStringPrintf(dy, "select concat(\"vgPrb_\",e.id), e.seq" " from vgPrb e, vgPrbAli a" " where e.id = a.vgPrb" " and a.db = '%s'" " and a.status = 'new'" " and e.taxon = %d" " and e.type <> 'bac'" " and e.seq <> ''" " order by e.id" , db, taxon); //restore: rc = sqlSaveQuery(conn, dy->string, "blat.fa", TRUE); verbose(1,"rc = %d = count of sequences for blat, to get psls for taxon %d\n",rc,taxon); if (rc == 0) { unlink("blat.fa"); system("rm -f blatNearBest.psl; touch blatNearBest.psl"); /* make empty file */ return; } /* make .ooc and blat on kolossus */ safef(path1,sizeof(path1),"/gbdb/%s/%s.2bit",db,db); safef(path2,sizeof(path2),"%s/%s.2bit",getCurrentDir(),db); //restore: verbose(1,"copy: [%s] to [%s]\n",path1,path2); copyFile(path1,path2); safef(cmdLine,sizeof(cmdLine), "ssh kolossus 'cd %s; blat -makeOoc=11.ooc -tileSize=11" " -repMatch=1024 %s.2bit /dev/null /dev/null'", getCurrentDir(),db); //restore: system("date"); verbose(1,"cmdLine: [%s]\n",cmdLine); system(cmdLine); system("date"); safef(cmdLine,sizeof(cmdLine), "ssh kolossus 'cd %s; blat %s.2bit blat.fa -ooc=11.ooc -noHead blat.psl'", getCurrentDir(),db); //restore: system("date"); verbose(1,"cmdLine: [%s]\n",cmdLine); system(cmdLine); system("date"); /* using blat even with -fastMap was way too slow - took over a day, * so instead I will make a procedure to write a fake psl for the BACs * which you will see called below */ safef(path2,sizeof(path2),"%s.2bit",db); verbose(1,"rm %s\n",path2); unlink(path2); safef(path2,sizeof(path2),"11.ooc"); verbose(1,"rm %s\n",path2); unlink(path2); /* skip psl header and sort on query name */ safef(cmdLine,sizeof(cmdLine), "sort -k 10,10 blat.psl > blatS.psl"); verbose(1,"cmdLine=[%s]\n",cmdLine); system(cmdLine); /* keep near best within 5% of the best */ safef(cmdLine,sizeof(cmdLine), "pslCDnaFilter -globalNearBest=0.005 -minId=0.96 -minNonRepSize=20 -minCover=0.50" " blatS.psl blatNearBest.psl"); verbose(1,"cmdLine=[%s]\n",cmdLine); system(cmdLine); unlink("blat.fa"); unlink("blat.psl"); unlink("blatS.psl"); freez(&blatSpec); dyStringFree(&dy); } void static assembleAllPsl(struct sqlConnection *conn, int taxon, char *db) /* assemble NonBlat.psl from variouls psl alignments */ { // " blatNearBest.psl" not included /* make final psl */ system( "cat" " fakeBAC.psl" " flatAll.psl" " flatRef.psl" " genRef.psl" " genbank.psl" " kgAlAll.psl" " kgAlRef.psl" " linkAll.psl" " linkRef.psl" " refSeq.psl" " > vgPrbNonBlat.psl" ); verbose(1,"vgPrbNonBlat.psl assembled for taxon %d\n",taxon); //unlink("blatNearBest.psl"); //unlink("fakeBAC.psl"); //system("ls -ltr"); } static void rollupPsl(char *pslName, char *table, struct sqlConnection *conn, char *db) { char cmd[256]; char dbTbl[256]; if (fileSize(pslName)==0) return; safef(dbTbl,sizeof(dbTbl),"%s.%s",db,table); if (!sqlTableExists(conn, dbTbl)) { verbose(1,"FYI: Table %s does not exist\n",dbTbl); safef(cmd,sizeof(cmd),"rm -f %s.psl; touch %s.psl",table,table); /* make empty file */ verbose(1,"%s\n",cmd); system(cmd); } else { dumpPslTable(conn, db, table); } safef(cmd,sizeof(cmd),"cat %s %s.psl | sort -u | sort -k 10,10 > %sNew.psl", pslName, table, table); verbose(1,"%s\n",cmd); system(cmd); safef(cmd,sizeof(cmd),"hgLoadPsl %s %sNew.psl -table=%s",db,table,table); verbose(1,"%s\n",cmd); system(cmd); safef(cmd,sizeof(cmd),"rm %s %s.psl %sNew.psl",pslName,table,table); verbose(1,"%s\n",cmd); //system(cmd); } static int findTaxon(struct sqlConnection *conn, char *db) /* return the taxon for the given db, or abort */ { char sql[256]; int taxon = 0; char *fmt = "select ncbi_taxa_id from go.species " "where concat(genus,' ',species) = '%s'"; sqlSafef(sql,sizeof(sql),fmt,hScientificName(db)); taxon = sqlQuickNum(conn, sql); if (taxon == 0) { if (sameString(db,"nibb")) /* we don't really have this frog as an assembly */ taxon = 8355; /* Xenopus laevis - African clawed frog */ /* can put more here in future */ } if (taxon == 0) errAbort("unknown taxon for db = %s, unable to continue until its taxon is defined.",db); return taxon; } static void makeFakeProbeSeq(struct sqlConnection *conn, char *db) /* get probe seq from primers, bacEndPairs, refSeq, genbank, gene-name */ { int taxon = findTaxon(conn,db); //restore: doPrimers(conn, taxon, db); //restore: doBacEndPairs(conn, taxon, db); //restore: doAccessionsSeq(conn, taxon, db); } /* keep around, but dangerous in the wrong hands ;) static void init(struct sqlConnection *conn) / * build tables - for the first time * / { if (!sqlTableExists(conn, "vgPrb")) { initTable(conn, "vgPrb", FALSE); / * this most important table should never be nuked automatically * / sqlUpdate(conn, NOSQLINJ "create index tName on vgPrb(tName(20));"); sqlUpdate(conn, NOSQLINJ "create index seq on vgPrb(seq(40));"); } initTable(conn, "vgPrbMap", TRUE); sqlUpdate(conn, NOSQLINJ "create index probe on vgPrbMap(probe);"); sqlUpdate(conn, NOSQLINJ "create index vgPrb on vgPrbMap(vgPrb);"); initTable(conn, "vgPrbAli", TRUE); initTable(conn, "vgPrbAliAll", TRUE); } */ static void doAlignments(struct sqlConnection *conn, char *db) { int taxon = findTaxon(conn,db); populateMissingVgPrbAli(conn, taxon, db, "vgPrbAli"); updateVgPrbAli(conn, db, "vgPrbAli","vgProbes"); doAccessionsAli(conn, taxon, db); doFakeBacAli(conn, taxon, db); assembleAllPsl(conn, taxon, db); rollupPsl("vgPrbNonBlat.psl", "vgProbes", conn, db); updateVgPrbAli(conn, db, "vgPrbAli","vgProbes"); doBlat(conn, taxon, db); rollupPsl("blatNearBest.psl", "vgProbes", conn, db); updateVgPrbAli(conn, db, "vgPrbAli","vgProbes"); markNoneVgPrbAli(conn, taxon, db, "vgPrbAli"); } static void getPslMapAli(struct sqlConnection *conn, char *db, int fromTaxon, char *fromDb, boolean isBac) { int rc = 0; struct dyString *dy = dyStringNew(0); char outName[256]; /* get {non-}bac $db.vgProbes not yet aligned */ dyStringClear(dy); sqlDyStringPrintf(dy, "select m.matches,m.misMatches,m.repMatches,m.nCount,m.qNumInsert,m.qBaseInsert," "m.tNumInsert,m.tBaseInsert,m.strand," "m.qName,m.qSize,m.qStart,m.qEnd,m.tName,m.tSize,m.tStart,m.tEnd,m.blockCount," "m.blockSizes,m.qStarts,m.tStarts" " from vgPrb e, vgPrbAliAll a, %s.vgProbes m" " where e.id = a.vgPrb and a.db = '%s' and a.status='new'" " and m.qName = concat(\"vgPrb_\",e.id)" " and e.taxon = %d and e.type %s 'bac' and e.state='seq' and e.seq <> ''" " order by m.tName,m.tStart" ,fromDb,db,fromTaxon, isBac ? "=" : "<>"); rc = 0; safef(outName,sizeof(outName), isBac ? "bac.psl" : "nonBac.psl"); rc = sqlSaveQuery(conn, dy->string, outName, FALSE); verbose(1,"Count of %s Psls found for pslMap: %d\n", isBac ? "bac" : "nonBac", rc); } static void getPslMapFa(struct sqlConnection *conn, char *db, int fromTaxon) { int rc = 0; struct dyString *dy = dyStringNew(0); /* get .fa for pslRecalcMatch use */ dyStringClear(dy); sqlDyStringPrintf(dy, "select concat(\"vgPrb_\",e.id), e.seq" " from vgPrb e, vgPrbAliAll a" " where e.id = a.vgPrb" " and a.db = '%s'" " and a.status = 'new'" " and e.taxon = %d" " and e.seq <> ''" " order by e.id" , db, fromTaxon); //restore: rc = sqlSaveQuery(conn, dy->string, "pslMap.fa", TRUE); verbose(1,"rc = %d = count of sequences for pslMap for taxon %d\n",rc,fromTaxon); } static void doPslMapAli(struct sqlConnection *conn, int taxon, char *db, int fromTaxon, char *fromDb) { char cmd[256]; struct dyString *dy = dyStringNew(0); char path[256]; char dnaPath[256]; char toDb[12]; safef(toDb,sizeof(toDb),"%s", db); toDb[0]=toupper(toDb[0]); safef(dnaPath,sizeof(dnaPath),"/cluster/data/%s/nib", db); if (!fileExists(dnaPath)) { safef(dnaPath,sizeof(dnaPath),"/cluster/data/%s/%s.2bit", db, db); if (!fileExists(dnaPath)) errAbort("unable to locate nib dir or .2bit for %s: %s", db, dnaPath); } safef(path,sizeof(path),"/gbdb/%s/liftOver/%sTo%s.over.chain.gz", fromDb, fromDb, toDb); if (!fileExists(path)) errAbort("unable to locate chain file %s",path); /* get non-bac $db.vgProbes not yet aligned */ getPslMapAli(conn, db, fromTaxon, fromDb, FALSE); /* get bac $db.vgProbes not yet aligned */ getPslMapAli(conn, db, fromTaxon, fromDb, TRUE); /* get .fa for pslRecalcMatch use */ getPslMapFa(conn, db, fromTaxon); /* non-bac */ safef(cmd,sizeof(cmd), "zcat %s | pslMap -chainMapFile -swapMap nonBac.psl stdin stdout " "| sort -k 14,14 -k 16,16n > unscoredNB.psl" ,path); verbose(1,"%s\n",cmd); system(cmd); safef(cmd,sizeof(cmd), "pslRecalcMatch unscoredNB.psl %s" " pslMap.fa nonBac.psl" ,dnaPath); verbose(1,"%s\n",cmd); system(cmd); /* bac */ safef(cmd,sizeof(cmd), "zcat %s | pslMap -chainMapFile -swapMap bac.psl stdin stdout " "| sort -k 14,14 -k 16,16n > unscoredB.psl" ,path); verbose(1,"%s\n",cmd); system(cmd); safef(cmd,sizeof(cmd), "pslRecalcMatch unscoredB.psl %s" " pslMap.fa bacTemp.psl" ,dnaPath); verbose(1,"%s\n",cmd); system(cmd); safef(cmd,sizeof(cmd), "pslCDnaFilter -globalNearBest=0.00001 -minCover=0.05" " bacTemp.psl bac.psl"); verbose(1,"%s\n",cmd); system(cmd); safef(cmd,sizeof(cmd),"cat bac.psl nonBac.psl > vgPrbPslMap.psl"); verbose(1,"%s\n",cmd); system(cmd); dyStringFree(&dy); } static void doAlignmentsPslMap(struct sqlConnection *conn, char *db, char *fromDb) { int taxon = findTaxon(conn,db); int fromTaxon = findTaxon(conn,fromDb); populateMissingVgPrbAli(conn, fromTaxon, db, "vgPrbAliAll"); updateVgPrbAli(conn, db, "vgPrbAliAll","vgAllProbes"); doPslMapAli(conn, taxon, db, fromTaxon, fromDb); rollupPsl("vgPrbPslMap.psl", "vgAllProbes", conn, db); updateVgPrbAli(conn, db, "vgPrbAliAll","vgAllProbes"); markNoneVgPrbAli(conn, fromTaxon, db, "vgPrbAliAll"); } static void doReMapAli(struct sqlConnection *conn, int taxon, char *db, int fromTaxon, char *fromDb, char *track, char *fasta ) /* re-map anything in track specified that is not aligned, nor even attempted yet, using specified fasta file. */ { char cmd[256]; int rc = 0; struct dyString *dy = dyStringNew(0); char dbTrk[256]; safef(dbTrk,sizeof(dbTrk),"%s.%s",db,track); if (!sqlTableExists(conn, dbTrk)) errAbort("Track %s does not exist\n",dbTrk); if (!fileExists(fasta)) errAbort("Unable to locate fasta file %s",fasta); if (sqlTableExists(conn, "vgRemapTemp")) { sqlUpdate(conn, NOSQLINJ "drop table vgRemapTemp;"); } safef(cmd,sizeof(cmd), "hgPepPred %s generic vgRemapTemp %s " ,database,fasta); verbose(1,"%s\n",cmd); system(cmd); /* required for mysql 5 longtext for case-insensitive comparisons of blobs */ sqlUpdate(conn, NOSQLINJ "ALTER table vgRemapTemp modify seq longtext;"); sqlUpdate(conn, NOSQLINJ "create index seq on vgRemapTemp(seq(40));"); /* get remapped psl probes not yet aligned */ dyStringClear(dy); sqlDyStringPrintf(dy, "select m.matches,m.misMatches,m.repMatches,m.nCount,m.qNumInsert,m.qBaseInsert," "m.tNumInsert,m.tBaseInsert,m.strand," "concat('vgPrb_',e.id),m.qSize,m.qStart,m.qEnd,m.tName,m.tSize,m.tStart,m.tEnd,m.blockCount," "m.blockSizes,m.qStarts,m.tStarts" " from vgPrb e, vgPrbAliAll a, %s.%s m, vgRemapTemp n" " where e.id = a.vgPrb and a.db = '%s' and a.status='new'" " and m.qName = n.name and n.seq = e.seq" " and e.taxon = %d and e.state='seq' and e.seq <> ''" " order by m.tName,m.tStart" ,db,track,db,fromTaxon); rc = 0; rc = sqlSaveQuery(conn, dy->string, "vgPrbReMap.psl", FALSE); verbose(1,"Count of Psls found for reMap: %d\n", rc); sqlUpdate(conn, NOSQLINJ "drop table vgRemapTemp;"); dyStringFree(&dy); } static void doAlignmentsReMap( struct sqlConnection *conn, char *db, char *fromDb, char *track, char *fasta) /* re-map anything in track specified that is not aligned, nor even attempted yet, using specified fasta file. */ { int taxon = findTaxon(conn,db); int fromTaxon = findTaxon(conn,fromDb); populateMissingVgPrbAli(conn, fromTaxon, db, "vgPrbAliAll"); updateVgPrbAli(conn, db, "vgPrbAliAll","vgAllProbes"); doReMapAli(conn, taxon, db, fromTaxon, fromDb, track, fasta); rollupPsl("vgPrbReMap.psl", "vgAllProbes", conn, db); updateVgPrbAli(conn, db, "vgPrbAliAll","vgAllProbes"); markNoneVgPrbAli(conn, fromTaxon, db, "vgPrbAliAll"); } static void doSelfMapAli(struct sqlConnection *conn, int taxon, char *db) { char cmd[256]; /* get non-bac $db.vgProbes not yet aligned */ getPslMapAli(conn, db, taxon, db, FALSE); /* get bac $db.vgProbes not yet aligned */ getPslMapAli(conn, db, taxon, db, TRUE); safef(cmd,sizeof(cmd),"cat bac.psl nonBac.psl > vgPrbSelfMap.psl"); verbose(1,"%s\n",cmd); system(cmd); } static void doAlignmentsSelfMap( struct sqlConnection *conn, char *db) /* copy anything in vgProbes but not in vgAllProbes to vgAllProbes */ { int taxon = findTaxon(conn,db); populateMissingVgPrbAli(conn, taxon, db, "vgPrbAliAll"); updateVgPrbAli(conn, db, "vgPrbAliAll","vgAllProbes"); doSelfMapAli(conn, taxon, db); rollupPsl("vgPrbSelfMap.psl", "vgAllProbes", conn, db); updateVgPrbAli(conn, db, "vgPrbAliAll","vgAllProbes"); markNoneVgPrbAli(conn, taxon, db, "vgPrbAliAll"); } static void doSeqAndExtFile(struct sqlConnection *conn, char *db, char *table) { int rc = 0; char cmd[256]; char path[256]; char bedPath[256]; char gbdbPath[256]; char *fname=NULL; struct dyString *dy = dyStringNew(0); dyStringClear(dy); sqlDyStringPrintf(dy, "select distinct concat('vgPrb_',e.id), e.seq" " from vgPrb e join %s.%s v" " left join %s.seq s on s.acc = v.qName" " where concat('vgPrb_',e.id) = v.qName" " and s.acc is NULL" " order by e.id" , db, table, db); rc = sqlSaveQuery(conn, dy->string, "vgPrbExt.fa", TRUE); verbose(1,"rc = %d = count of sequences for vgPrbExt.fa, to use with %s track %s\n",rc,db,table); if (rc > 0) /* can set any desired minimum */ { safef(bedPath,sizeof(bedPath),"/cluster/data/%s/bed/visiGene/",db); if (!fileExists(bedPath)) { safef(cmd,sizeof(cmd),"mkdir %s",bedPath); verbose(1,"%s\n",cmd); system(cmd); } safef(gbdbPath,sizeof(gbdbPath),"/gbdb/%s/visiGene/",db); if (!fileExists(gbdbPath)) { safef(cmd,sizeof(cmd),"mkdir %s",gbdbPath); verbose(1,"%s\n",cmd); system(cmd); } while(1) { int i=0; safef(path,sizeof(path),"%svgPrbExt_AAAAAA.fa",bedPath); char *c = rStringIn("AAAAAA",path); srand( (unsigned)time( NULL ) ); for(i=0;i<6;++i) { *c++ += (int) 26 * (rand() / (RAND_MAX + 1.0)); } if (!fileExists(path)) break; } safef(cmd,sizeof(cmd),"cp vgPrbExt.fa %s",path); verbose(1,"%s\n",cmd); system(cmd); fname = rStringIn("/", path); ++fname; safef(cmd,sizeof(cmd),"ln -s %s %s%s",path,gbdbPath,fname); verbose(1,"%s\n",cmd); system(cmd); safef(cmd,sizeof(cmd),"hgLoadSeq %s %s%s", db, gbdbPath,fname); verbose(1,"%s\n",cmd); system(cmd); } dyStringFree(&dy); } int main(int argc, char *argv[]) /* Process command line. */ { struct sqlConnection *conn = NULL; char *command = NULL; optionInit(&argc, argv, options); database = optionVal("database", database); sqlPath = optionVal("sqlPath", sqlPath); if (argc < 2) usage(); command = argv[1]; if (argc >= 3) setCurrentDir(argv[2]); conn = sqlConnect(database); if (sameWord(command,"INIT")) { if (argc != 2) usage(); errAbort("INIT is probably too dangerous. DO NOT USE."); /* init(conn); */ } else if (sameWord(command,"POP")) { if (argc != 2) usage(); /* populate vgPrb where missing */ populateMissingVgPrb(conn); } else if (sameWord(command,"SEQ")) { if (argc != 4) usage(); /* make fake probe sequences */ makeFakeProbeSeq(conn,argv[3]); } else if (sameWord(command,"ALI")) { if (argc != 4) usage(); /* blat anything left that is not aligned, nor even attempted */ doAlignments(conn,argv[3]); } else if (sameWord(command,"EXT")) { if (argc != 4) usage(); /* update seq and extfile as necessary */ doSeqAndExtFile(conn,argv[3],"vgProbes"); } else if (sameWord(command,"PSLMAP")) { if (argc != 5) usage(); /* pslMap anything left that is not aligned, nor even attempted */ doAlignmentsPslMap(conn,argv[3],argv[4]); } else if (sameWord(command,"REMAP")) { if (argc != 7) usage(); /* re-map anything in track specified that is not aligned, nor even attempted yet, using specified fasta file. */ doAlignmentsReMap(conn,argv[3],argv[4],argv[5],argv[6]); } else if (sameWord(command,"SELFMAP")) { if (argc != 4) usage(); /* re-map anything in track specified that is not aligned, nor even attempted yet, using specified fasta file. */ doAlignmentsSelfMap(conn,argv[3]); } else if (sameWord(command,"EXTALL")) { if (argc != 4) usage(); /* update seq and extfile as necessary */ doSeqAndExtFile(conn,argv[3],"vgAllProbes"); } else usage(); sqlDisconnect(&conn); return 0; }