2311a511adc9311bf0b6b06b7eafa753f5021352 max Tue Dec 7 06:58:25 2021 -0800 adding issue template that directs people to our mailing list, refs #28554 diff --git src/hg/htdocs/goldenPath/help/query.html src/hg/htdocs/goldenPath/help/query.html index 656eaf1..da7157f 100755 --- src/hg/htdocs/goldenPath/help/query.html +++ src/hg/htdocs/goldenPath/help/query.html @@ -1,181 +1,185 @@ <!DOCTYPE html> <!--#set var="TITLE" value="Genome Browser Queries" --> <!--#set var="ROOT" value="../.." --> <!-- Relative paths to support mirror sites with non-standard GB docs install --> <!--#include virtual="$ROOT/inc/gbPageStart.html" --> <h1>Querying the Genome Browser</h1> <p> From the <a href="../../cgi-bin/hgGateway">Genomes page</a>, you can jump to the default position of an assembly by clicking the "Go" button or you can specify a particular genome position in a variety of formats. These same formats are valid in the search bar above the main <a href="../../cgi-bin/hgTracks">Genome Browser track display</a>.</p> <p> Valid position queries can include:</p> <ul> <li> Chromosome numbers</li> <li> Chromosomal coordinate ranges</li> <li> Gene names</li> <li> Accession numbers</li> <li> An mRNA, EST or STS marker</li> <li> Keywords from the GenBank description of an mRNA</li> <li> <a href="http://varnomen.hgvs.org/" target="_blank">HGVS</a> terms</li> </ul> <p> To specify a genome position:</p> <ol> <li> Select the desired clade, genome and assembly</li> <li> Enter the desired query in the "Position/Search Term" box (see sample queries below)</li> <li> Click the "Go" button</li> </ol> <p> Note: A query may have multiple results. If this is the case, a results page will appear listing each result along with the track it is associated with. Once selected, the result will be displayed in the Browser with a highlighted tag, making it easier to identify. Also, if you have further questions, you can search the <a href="/FAQ/index.html" target="_blank">Genome Browser FAQ</a> page and find links to further resources.</p> <h2>Sample queries</h2> <p> Below is a list of examples that might be used to query the Genome Browser. Note that not every query listed here will produce a result in every assembly. The list serves only to illustrate the different types of queries that can be performed. <table border="1"> <tr><th width="200">Query</th><th>Genome Browser Response</th></tr> <tr> <td>chr7</td> <td>Displays all of chromosome 7</td></tr> <tr> <td>chr3:1-1000000</td> <td>Displays the first million bases of chromosome 3, counting from the p-arm telomere</td></tr> <tr> <td>3:1-1000000</td> <td>Displays the first million bases of chromosome 3, Ensembl format chromosome names</td></tr> <tr> <td>chr3 0 1000000</td> <td>Displays the first million bases of chromosome 3; BED format</td></tr> <tr> <td>NC_000007.14:1-1000000</td> <td>Displays the first million bases of chromosome 3, RefSeq format</td></tr> <tr> <td>CM000665.2:1-1000000</td> <td>Displays the first million bases of chromosome 3, GenBank/INSDC format</td></tr> <tr> <td>chr3:1000000+2000</td> <td>Displays a region of chromosome 3 that spans 2000 bases, starting with position 1000000</td> </tr> <tr> <td>chrUn_GL000213v1</td> <td>Displays all of the unplaced contig GL000213v1</td></tr> <tr> <td>chr3_GL000221v1_random</td> <td>Displays the unlocalized contig GL000221v1</td></tr> <tr> <td>chr1_KN196472v1_fix</td> <td>Displays all of patch fix KN196472v1</td></tr> <tr> <td>20p13</td> <td>Displays the region for band p13 on chromosome 20</td></tr> <tr> <tr> <td>GTATGTAGCCACGGAGCACCATTACCTGTCACCATTACCTGAATGGCTA</td> <td>Displays the first best match to this DNA sequence, e.g. chr21:33034835-33034883 for hg19</td></tr> <tr> <td>AA205474</td> <td>Displays the region containing the EST with GenBank accession AA205474 in the BRCA1 cancer gene on chromosome 17</td></tr> <tr> <td>AC008101</td> <td>Displays the region containing the clone with GenBank accession AC008101</td></tr> <tr> <td>AF083811</td> <td>Displays the region containing the mRNA with GenBank accession number AF083811</td></tr> <tr> <td>NM_017414</td> <td>Displays the region containing RefSeq identifier NM_017414</td></tr> <tr> <td>NP_059110</td> <td>Displays the region containing protein accession number NP_059110</td></tr> <tr> <td>PRNP</td> <td>Displays the region containing HUGO Gene Nomenclature Committee identifier PRNP</td></tr> <tr> + <tr> + <td>Q99697</td> + <td>Displays the region containing the alignment of the UniProt/SwissProt protein sequence with accession Q99697 (PITX2)</td></tr> + <tr> <td nowrap>RH18061;RH80175<br>15q11;15q13<br>NM_012090.5;NM_012421.4</td> <td nowrap>Displays the region between genome landmarks, such as the STS markers RH18061 and RH80175, or chromosome<br> bands 15q11 to 15q13, or SNPs NM_000310.4 and NM_012090.5. This syntax may also be used for other range queries,<br>such as between uniquely determined ESTs, mRNAs, refSeqs, SNPS, etc.</td></tr> <tr id="HGVS"> <td nowrap>NM_000310.4(PPT1):c.271_287del17insTT<br> NM_007262.5(PARK7):c.-24+75_-24+92dup<br> NM_006172.4(NPPA):c.456_*1delAA<br> MYH11:c.503-14_503-12del<br> NM_198576.4(AGRN):c.1057C>T<br> NM_198056.3:c.1654G>T<br> NP_002993.1:p.Asp92Glu<br> NP_002993.1:p.D92E<br> BRCA1 Ala744Cys<br> BRCA1 A744C<br> LRG_100t1:c.4G>A<br> LRG_100t1:n.1<br> LRG_456p1:p.Ser190Leu<br>LRG_321:g.16409_16461del<br>ENST00000002596.6:c.-108-6848A>G<br> ENSP00000005178.5:p.Val20Gly<br> chrX:g.31500000_31600000del<br> NR_111987:n.-1 <br> NM_015102.5:n.3038-2<br> NM_001372044:c.1528_1530del</td> <td>Displays the region containing <a href="http://varnomen.hgvs.org/" target="_blank">HGVS</a> term</td></tr> <!-- commented out -- not working <tr> <td>15q11;15q13</td> <td>bands 15q11 to 15q13, or SNPs rs1042522 and rs1800370. This syntax may also be used for other range queries</td></tr> <tr> <td>rs1042522;rs1800370</td> <td>such as between uniquely determined ESTs, mRNAs, refSeqs, etc.</td></tr> --> <tr> <td>chr1 0 1000</td> <td>When entered without ":" and "-", uses 0-based, half-open coordinates (like custom tracks and internal table coordinates), so displays chr1:1-1000</td> </tr> <tr> <td>pseudogene mRNA</td> <td>Lists transcribed pseudogenes, but not cDNAs</td></tr> <tr> <td>p53</td> <td>Lists mRNAs related to the p53 tumor suppressor</td></tr> <tr> <td>T-cell receptor</td> <td>Lists mRNAs for T-cell receptor genes in GenBank</td></tr> <tr> <td>breast cancer</td> <td>Lists mRNAs associated with breast cancer</td></tr> <tr> <td>homeobox caudal</td> <td>Lists mRNAs for caudal homeobox genes</td></tr> <tr> <td>zinc finger</td> <td>Lists zinc finger mRNAs</td></tr> <tr> <td>kruppel zinc finger</td> <td>Lists only kruppel-like zinc fingers</td></tr> <tr> <td>huntington</td> <td>Lists candidate genes associated with Huntington's disease</td></tr> <tr> <td>zahler</td> <td>Lists mRNAs deposited by a scientist named Zahler</td></tr> <tr> <td>Evans,J.E.</td> <td>Lists mRNAs deposited by co-author J.E. Evans</td></tr> </table> <p> Use this last format for author queries. Although GenBank requires the search format <em>Evans JE</em>, internally it uses the format <em>Evans,J.E.</em>.</p> <!--#include virtual="$ROOT/inc/gbPageEnd.html" -->