e417eb7ff33edef9c0b33bb67360a9fc39fc9105
markd
  Sun Aug 21 08:49:17 2022 -0700
update bigRmsk track build documentation and provide a standard track description page

diff --git src/hg/htdocs/goldenPath/help/bigRmsk.html src/hg/htdocs/goldenPath/help/bigRmsk.html
index c644765..ffe9ef3 100755
--- src/hg/htdocs/goldenPath/help/bigRmsk.html
+++ src/hg/htdocs/goldenPath/help/bigRmsk.html
@@ -1,306 +1,200 @@
 <!DOCTYPE html>
 <!--#set var="TITLE" value="Genome Browser bigRmsk RepeatMasker Format" -->
 <!--#set var="ROOT" value="../.." -->
 
 <!-- Relative paths to support mirror sites with non-standard GB docs install -->
 <!--#include virtual="$ROOT/inc/gbPageStart.html" -->
 
 <h1>bigRmsk Track Format</h1>
 
 <p>
 The bigRmsk format allows for the display of annotations of a genome generated by the
-<a href="http://www.repeatmasker.org" "target=_blank">RepeatMasker</a>
+<a href="http://www.repeatmasker.org/" target="_blank">RepeatMasker</a>
 program that screens DNA sequences for interspersed repeats and low complexity DNA sequences.
-The output of RepeatMasker is a detailed annotation of the repeats that are present in
-the &quot;query&quot; sequence as well as a modified version of this query sequence
-in which all the annotated repeats have been masked, where the default replaces
-the discovered repeats by Ns. The bigRmsk format enables taking the annotation output
-of RepeatMasker and converting it into a compressed and indexed version of a
-<a href="/goldenPath/help/bigBed.html">bigBed</a> file, where the results can be
-identified as <code>type bigRmsk</code> in a Track Hub and can be visualized as described
-below.</p>
-<p>
-The bigRmsk files are created using the program <code>bedToBigBed</code>. It must be run with the 
-<code>-as</code> option to pull in a special <a href="http://www.linuxjournal.com/article/5949" 
-target="_blank">autoSql</a> (<em>.as</em>) file, <code>bigRmskBed.as</code> that defines the fields
-of bigRmsk. Along with the bigRmsk file, an auxiliary data bigBed can be made, with its own .as
-definitions file (<code>bigRmskAlignBed.as</code>) and referenced with a special <code>xrefDataUrl</code>
-setting, whereas the bigRmsk file location is named with the standard <code>bigDataUrl</code> setting.</p>
+</p>
 <p>
-The bigRmsk files are in an indexed binary format. The main advantage of this format is that only 
-those portions of the file needed to display a particular region are transferred to the Genome 
-Browser server. Because of this, bigRmsk files have considerably faster display performance than
-if they were stored in a text-based format. The bigRmsk file remains on your local 
-web-accessible server (http, https or ftp), not on the UCSC server, and only the portion needed for 
-the currently displayed chromosomal position is locally cached as a &quot;sparse file&quot;. If you
-do not have access to a web-accessible server and need hosting space for your bigRmsk files, please
-see the <a href="hgTrackHubHelp.html#Hosting">Hosting</a> section of the Track Hub Help
-documentation.</p>
+The bigRmsk format enables taking the annotation output of RepeatMasker and
+converting it into a compressed and indexed
+<a href="/goldenPath/help/bigBed.html">bigBed</a> file.  Please see this page
+for a details of the bigBed format, its use, and associated tools.
+</p>
 
-<h2 id="bigRmsk">bigRmsk file definitions</h2>
+<h2 id="bigRmsk">bigRmsk track definitions</h2>
 <p>
-The following autoSql definition is used to specify the main bigRmsk files. This
-definition, contained in the file <a href="examples/bigRmsk.as"><em>bigRmsk.as</em></a>, is 
-pulled in when the <code>bedToBigBed</code> utility is run with the <code>-as=bigRmsk.as</code> 
-option. </p>
-<h6>bigRmsk.as</h6>
-<pre><code>table bigRmskBed
-"Repetitive Element Annotation" 
-    (
-    string  chrom;        "Reference sequence chromosome or scaffold" 
-    uint    chromStart;    "Start position of visualization on chromosome" 
-    uint    chromEnd;    "End position of visualization on chromosome" 
-    string  name;        "Name repeat, including the type/subtype suffix" 
-    uint    score;        "Divergence score" 
-    char[1] strand;        "+ or - for strand" 
-    uint    thickStart;    "Start position of aligned sequence on chromosome" 
-    uint    thickEnd;    "End position of aligned sequence on chromosome" 
-    uint      reserved;    "Reserved" 
-    uint    blockCount;    "Count of sequence blocks" 
-    lstring blockSizes;     "A comma-separated list of the block sizes(+/-)" 
-    lstring blockStarts;    "A comma-separated list of the block starts(+/-)" 
-    uint    id;             "A unique identifier for the joined annotations in this record" 
-    lstring description;    "A comma separated list of technical annotation descriptions"
-    )</code></pre>
-<p>An example: <code>bedToBigBed -tab -as=bigRmsk.as -type=bed9+5 bigRmsk.txt
-hg38.chrom.sizes bigRmsk.bb</code>.</p>
+  The bigRmsk tracks consist of two bigBed files define by
+  <a href="http://www.linuxjournal.com/article/5949" target="_blank">autoSql</a> schema:
+</p>
+<ul>
+  <li>The primary bigRmsk file, define by <a href="examples/bigRmskBed.as"><em>bigRmskBed.as</em></a>,
+    which has the annotations of repeats.
+  <li>The secondary bigRmskAlign file, define by <a href="examples/bigRmskAlignBed.as"><em>bigRmskAlignBed.as</em></a>,
+    which contains the alignments of the consensus repeats to the genome.  This file is optional, if omitted,
+    the bigRmsk track will function, without the ability to view the alignments.
+</ul>
 
-<h3 id="supporting">Supporting bigRmskAlign.bb auxiliary data</h3>
 <p>
-Alongside the bigRmsk file, a supporting bigBed can provide alignment data. The following autoSql
-definition is used to create this supporting file, pointed to online with <code>xrefDataUrl</code>,
-rather than the standard <code>bigDataUrl</code> used with bigRmsk. The file
-<a href="examples/bigRmskAlignBed.as"><em>bigRmskAlignBed.as</em></a>, is pulled in when
-the <code>bedToBigBed</code> utility is run with the <code>-as=bigRmskAlignBed.as</code>
-option.</p>
-<h6>bigRmskAlignedBed.as</h6>
-<pre><code>table bigRmskAlignBed
-"Repetitive Element Alignment Auxiliary Data" 
-    (
-    string  chrom;        "Reference sequence chromosome or scaffold" 
-    uint    chromStart;    "Start position of alignment on chromosome" 
-    uint    chromEnd;    "End position of alignment on chromosome" 
-    uint    chromRemain;    "Remaining bp in the chromosome or scaffold" 
-    float   score;          "alignment score (sw, bits or evalue)" 
-    float   percSubst;      "Base substitution percentage" 
-    float   percDel;        "Base deletion percentage" 
-    float   percIns;        "Bases insertion percentage" 
-    char[1] strand;         "Strand - either + or -" 
-    string  repName;        "Name of repeat" 
-    string  repType;        "Type of repeat" 
-    string  repSubtype;     "Subtype of repeat" 
-    uint    repStart;       "Start in repeat sequence" 
-    uint    repEnd;         "End in repeat sequence" 
-    uint    repRemain;      "Remaining unaligned bp in the repeat sequence" 
-    uint    id;             "The ID of the hit. Used to link related fragments" 
-    lstring calignData;     "The alignment data stored as a single string" 
-    )</code></pre>
-<p>An example: <code>bedToBigBed -tab -as=bigRmskAlignBed.as -type=bed3+14
-bigRmskAlign.tsv.sorted.txt hg38.chrom.sizes bigRmskAlign.bb
-</code>.CHECK - ISSUE IS xrefDataUrl doesn't work on this data yet.</p>
+  The input files for the bigRmsk files are create from the RepeatMasker <em>*.out</em> and <em>*.align</em> files
+  using the <em>rmToTrackHub.pl</em> program that is include with RepeatMasker.  The bigRmsk
+  format is not designed to work with any other type of data.
 </p>
-<p>
-Note that the <code>bedToBigBed</code> utility uses a substantial amount of memory: approximately 
-25% more RAM than the uncompressed BED input file.</p>
+
 
 <h2 id="steps">Creating a bigRmsk track</h2>
 <p>
-To create a bigRmsk track, and its supporting file, follow the below steps. All input
-files into <code>bedToBigBed</code> must be sorted on the coordinates of the first two columns,
-<code>sort -k1,1 -k2,2n input.tsv.txt &gt;  input.tsv.sorted.txt</code>. To learn about a perl
-program that can build the tab-separated values (tsv) input bedToBigBed text files from the
-RepeatMasker output files, contact Robert Hubley: <a href="https://github.com/rmhubley"
-target="_blank">https://github.com/rmhubley</a>.</p> 
+  To create a bigRmsk track, and its supporting files, follow the below steps.
+  This assumes that you have already run RepeatMasker and have a <em>*.out</em>, and
+  optionally <em>*.align</em> file.
+</p>
+
+<p>
+  RepeatMasker output files are convert to the bigRmsk textual form using the
+  <em>RepeatMasker/util/rmToTrackHub.pl</em> program that is part of the RepeatMasker distribution.
+</p>
+<p>
+  NOTE: The current version of RepeatMasker (4.1.2-p1) does not contain the
+  <em>rmToTrackHub.pl</em> program.  Until it is available in, obtain a copy
+  from the RepeatMasker GitHub development branch:
+</p>
+    <pre>
+      <code>
+      git clone -b development git@github.com:rmhubley/RepeatMasker.git
+      </code>
+    </pre>
+
 <p>
   <strong>Step 1.</strong>
-If you already have an input file you would like to convert to a bigRmsk, skip to <em>Step 3</em>.
-Otherwise, download <a href="examples/bigRmsk.txt">this example bigRmsk.txt
-file</a> for the human GRCh38 (hg38) assembly.</p>
+  If you wish to experiment with quickly building an example track, download the
+  example RepeatMasker output files for the human GRCh38 (hg38) assembly
+  <a href="examples/bigRmskExample.out">bigRmskExample.out</a>
+  and <a href="examples/bigRmskExample.align">bigRmskExample.align</a>
+  used in this tutorial:
+  <pre>
+    <code>
+      wget https://genome.ucsc.edu/goldenPath/help/examples/bigRmskExample.out
+      wget https://genome.ucsc.edu/goldenPath/help/examples/bigRmskExample.align
+    </code>
+  </pre>
 <p>
-<strong>Step 2.</strong> 
-If you would like to include the optional auxiliary alignment data <code>bigRmskAlign.bb</code> file,
-download the bigRmskAlign.txt file.</p>
+  Otherwise, substitute your <em>*.out</em> and <em>*.align</em> in theses instructions.
+  Generating the alignment bigRmsk file is optional if you don&apos;t have the <em>*.align</em>
+  files from RepeatMasker, the track will function with reduced functionality without them.  Just skip the
+  steps involved in build the alignment files.
+
 <p>
-<strong>Step 3.</strong> 
-Download the autoSql file <em><a href="examples/bigRmsk.as">bigRmsk.as</a></em> needed by 
-<code>bedToBigBed</code>. If you have opted to include the optional auxiliary alignment data file,
-bigRmskAlign.bb, with your bigRmsk file, you must also download the autoSql file
-<a href="examples/bigRmskAlignBed.as">bigRmskAlignBed.as</a>.</p>
+  <strong>Step 2.</strong>
+  Download the autoSql schemes <a href="examples/bigRmskBed.as">bigRmskBed.as</a> and
+  <a href="examples/bigRmskAlignBed.as">bigRmskAlignBed.as</a>:
+  <pre>
+    <code>
+      wget https://genome.ucsc.edu/goldenPath/help/examples/bigRmskBed.as
+      wget https://genome.ucsc.edu/goldenPath/help/examples/bigRmskAlignBed.as
+    </code>
+  </pre>
 <p>
-Here are wget commands to obtain the above files and the hg38.chrom.sizes file mentioned below:
-<pre><code>wget https://genome.ucsc.edu/goldenPath/help/examples/
-wget https://genome.ucsc.edu/goldenPath/help/examples/bigRmsk.txt
-wget https://genome.ucsc.edu/goldenPath/help/examples/bigRmskAlign.txt
-wget https://genome.ucsc.edu/goldenPath/help/examples/bigRmsk.as
-wget https://genome.ucsc.edu/goldenPath/help/examples/bigRmskAlign.as
+  You will also need a file of chromosome sizes for your genome, or download the hg38
+  file for the example:
+  <pre>
+    <code>
       wget http://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.chrom.sizes
-</code></pre>
+    </code>
+  </pre>
 <p>
-<strong>Step 4.</strong> 
-Download the <code>bedToBigBed</code> program from the UCSC
-<a href="http://hgdownload.soe.ucsc.edu/admin/exe/">binary utilities directory</a>.</p>
+  <strong>Step 3.</strong>
+  Convert the RepeatMasker files to the text format bigRmsk files for conversion to the bigRmsk files with
+  <em>rmToTrackHub.pl</em>, which sorts the output for direct input to <em>bedToBigBed</em>:
+  <pre>
+    <code>
+      RepeatMasker/util/rmToTrackHub.pl -out bigRmskExample.out -align bigRmskExample.align
+    </code>
+  </pre>
 <p>
-<strong>Step 5.</strong> 
-Download the  <em>chrom.sizes</em> file for any assembly hosted at UCSC from our 
-<a href="http://hgdownload.soe.ucsc.edu/downloads.html">downloads</a> page (click on &quot;Full 
-data set&quot; for any assembly). For example, the <em>hg38.chrom.sizes</em> file for the hg38 
-database is located at 
-<a href="http://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.chrom.sizes" 
-target="_blank">http://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.chrom.sizes</a>.</p>
+  <strong>Step 4.</strong>
+  Build the bigRmsk and optional bigRmskAlign files:
   <pre>
-<code>bedToBigBed -tab -as=bigRmsk.as -type=bed9+5 bigRmsk.txt hg38.chrom.sizes bigRmsk.bb</code></pre>
+    <code>
+      bedToBigBed -tab -type=bed9+5 -as=bigRmskBed.as bigRmskExample.join.tsv hg38.chrom.sizes bigRmskExample.bb
+      bedToBigBed -tab -type=bed3+14 -as=bigRmskAlignBed.as bigRmskExample.align.tsv hg38.chrom.sizes bigRmskExampleAlign.bb
+    </code>
+  </pre>
+
 <p>
 <strong>Step 6.</strong> 
-Move the newly created bigRmsk file (<em>bigRmsk.bb</em>) to a web-accessible http, https or ftp
-location. If you generated the <em>bigRmskAlign.bb</em> files move those to a web accessible
-location, likely same location as the <em>bigRmsk.bb</em> file.</p> 
-<p>
+Place the newly created bigRmsk file (<em>bigRmskExample.bb</em>), and optional
+bigRmskAlign (<em>bigRmskExampleAlign.bb</em>) to a web-accessible http, https
+or ftp location.
+</p>
 <strong>Step 7.</strong>
-Construct a <a href="hgTracksHelp.html#CustomTracks?db=hg38">custom track</a> using a single 
-<a href="hgTracksHelp.html#TRACK">track line</a>. Note that any of the track attributes listed 
-<a href="customTrack.html#TRACK">here</a> are applicable to tracks of type bigBed. The most basic
-version of the track line will look something like this:</p>
-<pre>track type=bigRmsk name="My bigRmsk" description="A RepeatMasker Track" bigDataUrl=http://myorg.edu/mylab/bigRmsk.bb</pre>
 <p>
-<strong>Step 8.</strong> 
-Paste the custom track line into the text box on the <a href="../../cgi-bin/hgCustom?db=hg38">custom
-track management page</a>. Navigate to chr1:1-21,571 to see the example data for this track.</p>
+  As with other bigBed-based tracks, bigRmsk tracks can be displayed as
+  <a href="hgTracksHelp.html#CustomTracks">custom tracks</a>,
+  included in <a href="hubQuickStart.html">track hubs</a>,
+  or <a href="hubQuickStartAssembly.html">assembly hubs</a>.
+</p>
+
+<p>
+  The following options are used for bigRmsk custom tracks or trackDb entries:
+  <ul>
+    <li> <code>type bigRmsk</code>
+    <li> <code>bigDataUrl<em>&lt;url&gt;</em></code> - URL or relative path of bigRmsk file
+    <li> <code>xrefDataUrl<em>&lt;url&gt;</em></code> - URL or relative path of optional bigRmskAlign file
+  </ul>
+
+  A standard bigRmsk track description is viable at  <a href="/bigRmskTrackDesc.html">/bigRmskTrackDesc.html</a>,
+  which can be directly to with as the file URL <em>/bigRmskTrackDesc.html</em>.
+
 <p>
-The <code>bedToBigBed</code> program can be run with several additional options. For a full
-list of the available options, type <code>bedToBigBed</code> (with no arguments) on the command line
-to display the usage message. </p>
+  See the <a href="#examples">Examples</a> section below for detailed examples of bigRmsk custom tracks
+  and track hub definitions.
+</p>
 
 <h2 id="examples">Examples</h2>
 
-<h3 id="example1">Example #1</h3>
+<h3 id="example1">Example of a bigRmsk custom track</h3>
 <p>
-In this example, you will create a bigRmsk custom track using an existing bigRmsk file,
-<em>bigRmsk.bb</em>, located on the UCSC Genome Browser http server. This file contains data for 
-the hg38 assembly.</p>
+Construct a <a href="hgTracksHelp.html#CustomTracks">custom track</a> using a single 
+<a href="hgTracksHelp.html#TRACK">track line</a>. Note that any of the track attributes listed 
+<a href="customTrack.html#TRACK">here</a> are applicable to tracks of type bigBed.
 <p>
-To create a custom track using this bigRmsk file: 
+To create a custom track using the example bigRmsk file: 
 <ol>
   <li>
-  Construct a track line that references the file:</p>
-  <pre><code>track type=bigRmsk name=&quot;bigRmsk Example One&quot; description=&quot;A bigRmsk file&quot; visibility=full bigDataUrl=http://genome.ucsc.edu/goldenPath/help/examples/bigRmsk.bb</code></pre></li>
+    Construct a track line that references the file:<br>
+    <pre><code>track type=bigRmsk name=&quot;bigRmsk Example&quot; description=&quot;RepeatMasker example&quot; visibility=full bigDataUrl=http://genome.ucsc.edu/goldenPath/help/examples/bigRmskExample.bb xrefDataUrl=http://genome.ucsc.edu/goldenPath/help/examples/bigRmskExampleAlign.bb</code></pre>
+  </li>
   <li>
-  Paste the track line into the <a href="../../cgi-bin/hgCustom?db=hg38">custom track management 
-  page</a> for the human assembly hg38 (Dec. 2013).</li> 
+    Paste the track line into the <a href="../../cgi-bin/hgCustom?db=hg38">custom track management page</a>
+    for the human assembly hg38 (Dec. 2013).
+  </li> 
   <li>
-  Click the &quot;submit&quot; button.</li>
+    Click the &quot;submit&quot; button.
+  </li>
   <li>
-  Navigate to <code>chr1:1-21,571</code> to see the track.
+    Navigate to <code>chr1:8,890-35,190</code> to see the track.
+  </li>
 </ol>
+<h3 id="example2">Example of a bigRmsk track hub </h3>
 <p>
-Custom tracks can also be loaded via one URL line. 
-<a href="http://genome.ucsc.edu/cgi-bin/hgTracks?db=hg38&position=chr1:1-21,571&hgct_customText=track%20type=bigRmsk%20name=Example%20bigDataUrl=http://genome.ucsc.edu/goldenPath/help/examples/bigRmsk.bb%20visibility=full"
-target="_blank">This link</a> loads the same <em>bigRmsk.bb</em> track and sets additional display 
-parameters in the URL:</p>
-<pre><code>http://genome.ucsc.edu/cgi-bin/hgTracks?db=hg38&position=chr1:1-21,571&hgct_customText=track%20type=bigRmsk%20name=Example%20bigDataUrl=http://genome.ucsc.edu/goldenPath/help/examples/bigRmsk.bb%20visibility=full</code></pre>
-<p>
-After this example bigRmsk is loaded in the Genome Browser, click into an item on the browser's 
-track display. Note that the details page display lacks information about the individual alignments, 
-as this example does not include the optional supporting alignment file.</p>
-<p>
-This example can also be loaded in a Track Hub with a stanza such as the following:</p>
+  This example can also be loaded in a Track or Assembly Hub <em>trackDb.txt</em>
+  with a stanza such as the following:</p>
 <pre>
-track ExBigRmsk
+    track bigRmskExample
     shortLabel Example bigRmsk
-longLabel This is an example Track Hub Stanza
+    longLabel This is an example bigRmsk Track Hub Stanza
     type bigRmsk
     visibility full
-bigDataUrl http://genome.ucsc.edu/goldenPath/help/examples/bigRmsk.bb
+    html /bigRmskTrackDesc.html
+    bigDataUrl http://genome.ucsc.edu/goldenPath/help/examples/bigRmskExample.bb
+    xrefDataUrl http://genome.ucsc.edu/goldenPath/help/examples/bigRmskExampleAlign.bb
+    html /bigRmskTrackDesc.html
 </pre>
 
-<!---
-NOTE: FOR WHEN REDOING PAGE, only Track Hubs now allow clicking into hgc. 
-NOTE: The below is innaccurate and just a holder for when <b>xrefDataUrl works</b> to give an example building it.
-
-Adding potential input file (this is from RobertH T2T hub), both the align.bb and bigRmsk.bb for a region are stashed below (not for hg38 though).
-
-$  bigBedToBed -chrom=chr1 -start=4513 -end=7608 https://hgdownload.soe.ucsc.edu/hubs/GCA/009/914/755/GCA_009914755.4/bbi/GCA_009914755.4_T2T-CHM13v2.0.t2tRepeatMasker/chm13v2.0_rmsk.align.bb stdout
-chr14082453324838279596227.3212.421.00-LTR60BLTRERV126476503TA/GTTACT/CGGGG/AAGG/TGCT/GGA/GT/AG/ATCC+T+CA/GGTTCTT+A+GTT/CTA/TACTTGGA/GAGAAAGAT/ATTT/CC/GA/GCCAAGAGG/ACAG/ATA/TC/TAA/GA/CG/CATG/AG/AC/AAGAT/GAAC/TTT-C-ATTGAAA/GA/GG/AAAAC/TAC/GAGT/AGT/CAA/GAGAGC/TTTATT+TAAAGAGACA+GTA+CACTCT+GAAAA/GATA/GG/AGGA/CG/AGAGT/CGGGCTG+CTGAAAG+AGC/AGTGC/AA/GT/CT/CAA/G+C+AA/GCAGCCT/C+C+A/GAGAGTC/TCTGT/CT/GC/TA/TGGA/GA/GA/TTTTTATT/N+ATG+TG/CGGACTTC/TTTC+TTG+AC/AA/GTTCCT/CGCCTCTGTCTC/TAAG-T-CTCCA/GCCTG/TTTTTCTTTGTCTG/AG+T+TTTTC/TCT+TAA+GC/TT/CA/CCT/CGCCTT-AG-C/NTCCCCGA/CCT+AG+TG/TCCCC/GA/CCT/CT/CAGGCTTGTGGGACC+CT+T/CCCTC/TACTGTG/CG/AGTTGA/GG/TGT/CA/GCATGT/CG+CGGGCC+T/CGGTGA/TTC/GA/GATACGAATC/TCA/TC/AT/CCTG/AG/AC/TA/GC/GCA/NGC+GTTG+CTCC/ATTC/ACCGCCAT/CCCCAGGC/AAC/GGC/TT/CG+T+AC/TAGCGA/GTCAC/AG/ATT/CTGTACC/TTAC/TTGT/CGCCTGC+GTAT+CTCTTT/AT/GGAAT-G-TC/TCTT/CCTC/TTGCCCT
-chr14533466024838266850520.477.870.00-LTR60BLTRERV11783144514AATCTGTACTTATG/TGG/CGCCA/TG+C+GTT/ATCTCTTAA/GGAATG/TTCC/TCT/CTTTG+CCCTCTT+G/TCCTT/CCTTAC/TCAA/GCATGTAGCTAGCA/TAT/CATTCTGACAT/GT/GTTT/AAT/CTGCAGAGG/TGAA/GT/CGATTG/A+CT+GGGCA/GTCTTC/AAGA/GGGA/CGTTC
-chr146635139248382189130422.814.201.43+L1MC_orf2LINEL12804329225GGTGA/CG/TGGAAC-GATT-AAT/CTGGAA/CA+T+CCAT/CAA/TGA/CAAT/AG/AAT/AATGC/AATA/CTAGAT/CG/AA/CAA/GACT/CTTACAA/CCT/CC/TA/TCACAAC/AT/AAA/TTC/AACTCAAAAT+GGAT+CATC/A+GA+CT/CTAC/AAC/TT/GA/TAAAAT/CGCT/AAAACTATAC/AAAT/CTT/CCTAGAAGA+T+AACA-A-TAGA/GAGAAAAG/TCTAT/GG/ATGC/ACT/CTTGGGTTTGGT/CA/GATGAA/CTTTTA/TAC/GAA/TAT/CG/AAT/CACA/CAAAGGT/C+A+T/CGAT+CC+ATA/GC/AAC/AA/GAAAG/NAAA/TTGAC/TAT/AT/GG/CTGGT/AT/CTTC+A+TTAAT/AATTT/AAAAG/AT/CTTA/CTA/GCTCTG+CG+G/AAAGACAC-CT-TGTT/CAAGAGAAC/TA/GAAAAGACAAGCCACAT/GAT/CTGA/G+G+AGAAAATATTTGCAAAAT/GACAC/TATCTGAG/TAAAGA/GAT/CTT/GG/TTC/ATT/CCAAAATATAT/CAAAA/GAAA/CTA/CTTAAAACTA/CAACAATAAGT/A+AAA+T/CAAACAG/ACCCA/GAC/TT+N+AAAAATGC/GA/GCAC/AAC/A+G+AT/CCTGAACAGACACCTCACCAAAGAAGATC/ATACAGATGGCAAG/ATAAA/GCATAC/TA/GAAAAGATGCTCA/NACAT
-chr14997526324838206588715.4612.782.74+L1MC3_3endLINEL129322395TTGTC/ATT/CCAAAATATAT/CAAAA/GAAA/CTA/CTTAAAACTA/CAACAATAAGT/A+AAA+T/CAAACAG/ACCCAAC/TTAAAAA+A+TGC/GA/GCAC/AAC/A+G+ATCTGAACAGACACCTCACCAAAGAAGATC/ATACAGATGGCAAG/ATAAA/GCATAC/TA/GAAAAGATGCTCAACAT+CATTTGTC+AC/TTAGA/GGAAC/TTG+CAAATT+AAAACC/AACAATGAGATAG/CCAC-AGCTGG-TC/AT/CAT/CAT/CCTC/ATTAGAAC/TT/GGCTAAAC/ATCC-CT-AAAAAA+C+TGACA+ATACC+AAT/NTGCTG+GCGAGGAT+GA/CGGAA/GA/CAACAA/GGAACTCTT/C+A+TTCATTGCC/TGGTGGA/GA
-chr152745528248381800140314.681.970.78+MER34C_vLTRERV12633226AGA/NCCAA/GAATATGCCACCCCAAAATATA/GAT/CG/TGTAGGAA/GACCAGAATATGCCACCCCAAAATATGT/CCC/TCTTTGT/GCT/ATAAGA/GATTATTC/TC/TA/GAGCTGATTATTTTGAA/GAAAA/CTA/GA/CAT/GG/AC-TA-ACAA/GA/GG/AGAAGT/CTCTGAAAACAGAGTAGAAGTTACCCTTG/TTGTAAGGA/GAAATTTACATCTATAAAGGAAATCC/TCCATTTA/G+T+AAA/GGC/GTA/GC/TCT+CC+CTCTCTA/GC/TACCAA/GGAAGAGAAGGATA/GA+CT+CTAAATCACTAA/GAGAG/CTCTT
-chr155285686248381642354424.566.810.65+L1MC3_3endLINEL181296815645TAATA/GGTGG-G-ATAT/CC/ATGACACA/TAC/TGCATTTA/GTCAAG/AAT/CA/CCAC/TAGAAT/CTTTAT/CG/AGC+A+CAAA-T-GG/AGTA/GAAT/CCA/TA/TAT/ATC/GTATT/GCAAATTA/TA/TAC/AAAAATT/CAC/TTC/TAGGAT/GGT+C+GGC/GGT/GATCCCAGGAC/TA/GGAATGCAT/GC/AA/NTGTGA+C+AAAAG/NAATT/CTA-T-G/ACTA/GC/TAA/T-A-T
-chr156866131248381197244214.805.841.29+MSTA1LTRERVL-MaLR46507TA/GCTATGGTTTGGATGT-GGT-TTGTCCCCGCA/CAAAACTCATGTTGAAATTTGAC/TCCCCAATGTGGCAGTGTG/TGGG/A-C-GGTGGGGCCTAGTGGA/GT/AGGTGTTTGGGTCATGGGGA/GT/CGGATCCCTCATGAATAGATTAATGT/CCCTCC+CTCGNG+A/GTGGGG/NGTGAGTGAGTA/TCT+C+GCTCT+NN+CA/GT/CA/GGGAATGGATTAA/GTTCCT/CGCA/GG/AGAGT/CA/GGGTA/TA/GTTAAAAAGAGTCTGGC+GNC+TT/CCCTT/CG/CG/TCT+CTC+TCC/TCTT+GC+TTGCTTT/CCA/TCTT/CTT/CGCT/CATGTGATCTCTG-G-T/CG/ACACC/GCCT/C-T-GCTCCCCTTCC+NCTTC+GCTTTCCA/GCCATGAGG/TT/NGAAA/GA/CAGA/CCTGAA/GGCCC+T+CACCAGATGCAA/GCTGCCCA/GA/NT/ACT/CC/NG/TGA/CC/TA/TTTC+GNC+CAGCT/CACCAGT/AATT/CGTGAGCCAAATG/AAAT/CCTT/CTTTTA/CC/TTTATAAATTACCCAGCCTCAGGTATTCT/CGTTAC/TAGA/CAG/ACACAAG/AAT/CGGACTAAGACA
-chr161317132248380196354424.566.810.65+L1MC3_3endLINEL196920414915CAAATGTAG/TGT/AAAA/CAAC+C+TCACTGAAGGT/GGG+TG+A/GGGGAAAAT/AGGTGT/CTGACCTAAGTC/AACTTTGA/GAAATGAA/GTA/GGAA/GTCTG+T+G/AAGG/ACTG/AAAGGCAC/AA+A+T/GGAACTA/GTACT/ATC/AAT/GA/CAT/CTGG/TAT/CTA/CC/TAT/GTTT/GATAAAGTTA/GTTTCCA/CACA/GGA/GA/GGC/TAA/CC/GT/GGTG/TAACAATTG/CTA/GAA/NACCA/GCA/TG/ATG/AT/CC/ATGTAT+A+CTGGAG/ATA/TA/GAACAATG/TAC/AT/GTAC/AATA/GA/GG/ATC/GGCA/GGATGGTGGGAA/GCCAGC/GTTTCTCACTGTTGA/GAGTGGGAGG/NTTACAA/GATT/AAGCAAGA/GC/GGAGA/GAGGCTAGAATGATT/CCC/ATGTGA/GTAG/ATA/GGATC/TAGAGG/TTGGAGACATCAA/GC/TG/ATA/GAACTT/CATGC/TTTAGT/CTTAATATAGATACAC/GAC/TA/GGTTC/AT/CAC/TATAGAAAA/TC/ATTTATAA/GT/ATAG/TGTGTG/ATG/ATAG/CG/AT/CA/GGGTTAG+T+AC/TACACACATATAC/TTTCCTA/TGCA/TT/CTGC/TT/CAA/GT/C+TGA+GAGGGA/CCA/TAGAT/AA/GCAAT/C+GACACCCCAGTAGCAACGA+GT/CG/ACAT/CT/CC/TAGCA/GG/CCCAC/GATG/CTA/TA/GGTTT+C+TC/AC/AC/TACCATTC+TCCAA+TG/AAAAGGAAT/CCA+G+GGCTCT/CTTGA/GAGAAATGT/GCTGATA/TCTAGA/GACTGGGA/GCAGT/GAAATAT+ACAAG+AG/TGAGCCA/TGGAT/GA/CATCTG/TGA/TAGTA/GT/CCAGAAAGT+AAGG+AAGTA/GCT+C+AAAAAAAT/CT/CA/CAA/CA+ATGATGGGGG+TATA/GTCAAAC/GA/GA/GAA/CAT/CAA/GA/GAGCCAAT/CA/TA/GAAAC/GAGCTA/CCCG/AATGGCCAAC/AA/GCA/TGGAAG/CG/AAA/TTTGT/AGCAACAT/AAAT+A+G/AC/ATA+AAG+TAGTG/ATC/TGA/GATA/TATAA+C+CT/CAAAGC/TT/ATAAAG/ATAAT/ATATCT/CAG/TGT/AGTCT/CG/ATAT/CTT/GG/ATATAC/AC/ATAG/AG/ATG+ATTGAATA+AATAAG/AC/TAAATGGA/GGT/GT/AGC/AAT/GAG+AC+AAATCTCCT/CT/GTGCAA/GAAGAATTCCAAATAAC/TTG/TATGTAGAC/TACTCA/CGCCA/CTCAAGA/GAGGTGGAGC+A+C/TAACTCCT/CCACTCCG/TTAAGTGTGGGCTC/GT/CGCATAGTGACTTG/CCTC/TCA/CAAAGA-ACAC-A/GTG/ACAGTATGGAC/AAA/GGGA/GGGAAAAA+AGAG+TAACTTC/TACAGTGGAGAAAT/CCTGACAAACAG/CTAG/CCTCT/AGCCAA/GA/GTGATCC/AAA/GGTG/CAACAC/TCAAA/CG/AC/GTGAC/TAG/AT/GTCAC/TC/GTTGAG/TAA/GC/TATG
-chr171417533248379795121520.504.597.89+L1MC3_3endLINEL12150252935TGG/AGGGACATTCTACAAAAA/TT/ACCTGACCAA/GTC/ACTCCTCAG/AT/AG/ACTA/GTG/CAAGGTCATCAT/AG/AAG/A+C+AT/AGGAAAGC/TCTA/GAC/GAC/AACTGTCACAGCCAG/AGAA/GGAGCCTAT/AG+GAGACA+TGAT/CGT/ACTAC/AATGTC/AG/ATGC/TGGG/TATCCTGGATGGGATCCTGGG/AT/ACAGAG/AT/AAAGA/G+ACAT+TAG+GTAAA+AACTAAGGG/AAATCC/TA/GAATG/AAAA/GTATGA/GACTTTAGTTAATAAC/TAG/ATC/GTATCAG/ATATTGGTTCATTAAC/TTGTGG/ACAA-ATT-ATGTA-AGATATTAATAAG-CCAT-GTGAGACAC-ACTG/AATA/GG/TAAGATGTTAATAAG/TAGA/GGGAAACTA/GGGT+G+TG-C-GGC/GTAC/TATGGGAAA/CTCTCTG-CTTT-TT/AT/CTT/ATT/CTTG/CA/GCG/AATTTC/TTG/CTGTAAG/ATA/CA/TAAAAA/CA/TG/AA/TC/TG/CTAAAATAAAAC/A+G+TTTATTTA/TA/NAA
-
-That is matched with
-
-$ bigBedToBed -chrom=chr1 -start=4513 -end=7608 https://hgdownload.soe.ucsc.edu/hubs/GCA/009/914/755/GCA_009914755.4/bbi/GCA_009914755.4_T2T-CHM13v2.0.t2tRepeatMasker/chm13v2.0_rmsk.bb stdout
-chr107536L1MC3#LINE/L1223+46637533094912,600,518,158,0,1001,108,392,3-1,4663,-1,5528,-1,6131,-1,7141,-151304 19.6 8.0 2.0 chr1 4664 5263 (248382065) + L1MC3 LINE/L1 4913 5546 (2239) 5 ,3544 24.6 6.8 0.7 chr1 5529 5686 (248381642) + L1MC3 LINE/L1 6065 6221 (1564) 5 ,3544 24.6 6.8 0.7 chr1 6132 7132 (248380196) + L1MC3 LINE/L1 6222 7294 (491) 5 ,1215 20.5 4.6 7.9 chr1 7142 7533 (248379795) + L1MC3 LINE/L1 7403 7782 (3) 5 
-chr140824796LTR60B#LTR/ERV1273-40824533030,451,263-1,0,-1962 27.3 12.4 1.0 chr1 4083 4533 (248382795) C LTR60B LTR/ERV1 (0) 765 264 3 
-chr140824837LTR60B#LTR/ERV1205-4533466003451,127,177-1,451,-505 20.5 7.9 0.0 chr1 4534 4660 (248382668) C LTR60B LTR/ERV1 (451) 314 178 4 
-chr152675850MER34C_v#LTR/ERV1147+52745528036,254,322-1,7,-161403 14.7 2.0 0.8 chr1 5275 5528 (248381800) + MER34C_v LTR/ERV1 7 263 (322) 6 
-chr156856131MSTA1#LTR/ERVL-MaLR148+56866131030,445,0-1,1,-12442 14.8 5.8 1.3 chr1 5687 6131 (248381197) + MSTA1 LTR/ERVL-MaLR 1 465 (0) 7 
-
-End of excerpt from 2 bigBed files in T2T that could be potential input in future examples (could be colors are wrong in this second file).
-
-<h3 id="example2">Example #2</h2>
+<h2 id="share">Additional information</h2>
 <p>
-In this example, you will create a bigRmsk file from an existing bigRmsk input file, 
-<em>bigRmsk.txt</em>, located on the UCSC Genome Browser http server.</p>
-<ol>
-  <li>
-  Save the bed3+1 example file, <a href="examples/bigRmsk.txt"><em>bigRmsk.txt</em></a>, to your 
-  computer (<em>Step 6</em>, above).</li>
-  <li>
-  Save the autoSql file <a href="examples/bigRmsk.as"><em>bigRmsk.as</em></a> to your computer 
-  (<em>Step 3</em>, above).</li>
-  <li>
-  Download the 
-  <a href="http://hgdownload.soe.ucsc.edu/admin/exe/"><code>bedToBigBed</code> utility</a> 
- (<em>Step 4</em>, above).</li>
-  <li>
-  Save the <a href="hg38.chrom.sizes"><em>hg38.chrom.sizes</em> text file</a> to your computer. 
-  This file contains the chrom.sizes for the human (hg38) assembly (<em>Step 5</em>, above).</li>
-  <li>
-  Run the <code>bedToBigBed</code> utility to create a binary indexed MAF file (<em>Step 6</em>,
-  above):
-<pre><code>bedToBigBed -type=bed3+1 -tab -as=bigRmsk.as bigRmsk.txt hg38.chrom.sizes bigRmsk.bb</code></pre></li>
-  <li>
-  Move the newly created bigRmsk file (<em>bigRmsk.bb</em>) to a web-accessible location (<em>Step 
-  7</em>, above).</li>
-  <li>
-  Construct a track line that points to the bigRmsk file (<em>Step 8</em>, above).</li>
-  <li>
-  Create the custom track on the human assembly hg38 (Dec. 2013), and view it in the Genome Browser 
-  (<em>step 9</em>, above).</li>
-</ol>
--->
-<h2 id="share">Sharing your data with others</h2>
-<p>
-If you would like to share your bigRmsk data track with a colleague, learn how to create a URL by 
-looking at Example 6 on <a href="customTrack.html#EXAMPLE6">this page</a>.</p>
-
-<h2 id="extract">Extracting data from the bigRmsk format</h2>
-<p>
-Because bigRmsk files are an extension of bigBed files, which are indexed binary files, it can 
-be difficult to extract data from them. UCSC has developed the following programs to assist
-in working with bigBed formats, available from the 
-<a href="http://hgdownload.soe.ucsc.edu/admin/exe/">binary utilities directory</a>.</p>
-<ul>
-  <li>
-  <code>bigBedToBed</code> &mdash; converts a bigBed file to ASCII BED format.</li>
-  <li>
-  <code>bigBedSummary</code> &mdash; extracts summary information from a bigBed file.</li>
-  <li>
-  <code>bigBedInfo</code> &mdash; prints out information about a bigBed file.</li>
-</ul>
-<p>
-As with all UCSC Genome Browser programs, simply type the program name (with no parameters) at the 
-command line to view the usage statement.</p>
+  See the <a href="bigBed.html">bigBed documentation</a> for guidance on
+  sharing, trouble shooting and extracting data from bigRmsk files.
+</p>
 
-<h2 id="trouble">Troubleshooting</h2>
-<p>
-If you encounter an error when you run the <code>bedToBigBed</code> program, check your input 
-file for data coordinates that extend past the the end of the chromosome. If these are present, run 
-the <code>bedClip</code> program 
-(<a href="http://hgdownload.soe.ucsc.edu/admin/exe/">available here</a>) to remove the problematic
-row(s) in your input file before running the <code>bedToBigBed</code> program.</p> 
+<h2 id="credits">Credits</h2>
+The bigRmsk system was developed by Robert Hubley of the Institute for Systems Biology.
 
 <!--#include virtual="$ROOT/inc/gbPageEnd.html" -->