d5932e4051a4885f0036831cdfc5fbf1eb08a499
lrnassar
  Tue Oct 10 17:16:27 2023 -0700
Fixing broken blog links, refs #32439

diff --git src/hg/htdocs/goldenPath/help/twoBit.html src/hg/htdocs/goldenPath/help/twoBit.html
index 2fa2f16..a7eb4cb 100755
--- src/hg/htdocs/goldenPath/help/twoBit.html
+++ src/hg/htdocs/goldenPath/help/twoBit.html
@@ -27,31 +27,31 @@
   <pre><code>    faToTwoBit genome.fa genome.2bit</code></pre></li>
   <li>
   Use <code>twoBitInfo</code> to verify the sequences in this assembly and create a chrom.sizes 
   file, which is useful to construct the big* files in later processing steps:<br>
   <pre><code>    twoBitInfo genome.2bit stdout | sort -k2rn > genome.chrom.sizes</code></pre></li>
 </ol>
 <p>
 The twoBit commands can function with the .2bit file as a URL: 
 <pre><code>    twoBitInfo -udcDir=. http://your-website.edu/~user/genome.2bit | sort -k2nr > genome.chrom.sizes</code></pre></p>
 <p>
 Sequence can be extracted from the .2bit file with the <code>twoBitToFa</code> command, for example:
 <pre><code>    twoBitToFa -seq=chr1 -udcDir=. http://your-website.edu/~user/genome.2bit stdout > genome.chr1.fa</code></pre></p>
 
 <h3 id=extract>Examples of extracting sequences</h3>
 <p>
-See these series of blog posts about <a href="http://genome.ucsc.edu/blog/?s=programmatic"
+See these series of blog posts about <a href="https://genome-blog.gi.ucsc.edu/blog/?s=programmatic"
 target="_blank">Accessing the Genome Browser Programmatically</a> to see examples of extracting
 sequences remotely, such as the following:
 <pre>
 $ twoBitToFa http://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.2bit:chr1:100100-100200 stdout
 >chr1:100100-100200
 gcctagtacagactctccctgcagatgaaattatatgggatgctaaatta
 taatgagaacaatgtttggtgagccaaaactacaacaagggaagctaatt
 </pre></p>
 <p>
 Also, see the <a href="api.html#getData_examples"
 target="_blank">API getData functions</a> to see examples of using the URL, such as the following:</p>
 <p>
 <a href="https://api.genome.ucsc.edu/getData/sequence?genome=hg38;chrom=chr1;start=100100;end=100200"
 target="_blank">https://api.genome.ucsc.edu/getData/sequence?genome=hg38;chrom=chr1;start=100100;end=100200</a>
 <pre>