d5932e4051a4885f0036831cdfc5fbf1eb08a499
lrnassar
Tue Oct 10 17:16:27 2023 -0700
Fixing broken blog links, refs #32439
diff --git src/hg/htdocs/goldenPath/help/hgTracksHelp.html src/hg/htdocs/goldenPath/help/hgTracksHelp.html
index a7303ee..9ea6990 100755
--- src/hg/htdocs/goldenPath/help/hgTracksHelp.html
+++ src/hg/htdocs/goldenPath/help/hgTracksHelp.html
@@ -1,1640 +1,1640 @@
<!DOCTYPE html>
<!--#set var="TITLE" value="Genome Browser User's Guide" -->
<!--#set var="ROOT" value="../.." -->
<!-- Relative paths to support mirror sites with non-standard GB docs install -->
<!--#include virtual="$ROOT/inc/gbPageStart.html" -->
<!--#include virtual="$ROOT/redmineWidget.html" -->
<h1>Genome Browser User Guide</h1>
<h2>Contents</h2>
<div class="row">
<div class="col-md-4">
<h6><a href="#What">What does the Genome Browser do?</a></h6>
<h6><a href="#FineTuning">Configuring the Genome Browser display</a></h6>
<h6><a href="#IndivTracks">Annotation track descriptions</a></h6>
<h6><a href="#BLATAlign">Using BLAT alignments</a></h6>
<h6>Getting Started with:</h6>
<ul>
<li> <h6><a href="#GetStarted">Genome Browser Gateway</a></h6>
<li> <h6><a href="#TableBrowser">Table Browser</a></h6>
<li> <h6><a href="#Sessions">Using Sessions</a></h6>
<li> <h6><a href="hgGeneGraph.html">Gene and Pathway Viewer</a></h6>
<li> <h6><a href="#GenomeGraphs">Genome Graphs</a></h6>
</ul>
<h6><a href="#TrackFormatDNA">DNA text formatting</a></h6>
<h6><a href="#Convert">Converting data between assemblies</a></h6>
<h6><a href="#Download">Downloading genome data</a></h6>
<h6><a href="#CustomTracks">Creating and managing custom annotation tracks</a></h6>
<h6><a href="#TrackHubs">Getting started on Track Hubs</a></h6>
<h6><a href="#GenArkTrackHubs">Track Hubs for <em>GenArk</em> assembly hub</a></h6>
<h6><a href="#UseOneFile">Track Hubs in a single file</a></h6>
<h6><a href="#VisiGeneHelp">Using the VisiGene Image Browser</a></h6>
</div>
<div class="col-md-8">
<form name="googleForm1" method="get" action="https://www.google.com/search" onSubmit="document.googleForm1.q.value=document.googleForm1.qq.value+' site:genome.ucsc.edu/goldenPath/help';">
<p>
Search the Genome Browser help pages:
<input type="hidden" name="q" value="">
<input type="hidden" name="num" value="10">
<input type="hidden" name="filter" value="0">
<input type=text name=qq size=30 maxlength=255 value="">
<input type="submit" value="Submit">
</p>
</form>
<form name="googleForm2" method="GET" action="https://www.google.com/search" onSubmit="document.googleForm2.q.value=document.googleForm2.qq.value+' site:genome.ucsc.edu/';">
<p>
Search the entire Genome Browser website:
<input type="hidden" name="q" value="">
<input type="hidden" name="num" value="10">
<input type="hidden" name="filter" value="0">
<input type=text name=qq size=30 maxlength=255 value="">
<input type="submit" value="Submit">
</p>
</form>
<p>
<a href="https://groups.google.com/a/soe.ucsc.edu/forum/#!forum/genome" target="_blank">Browse</a>
the Genome Browser mailing list.</p>
<p>
<a href="../../contacts.html">Questions and feedback are welcome</a>.</p>
</div>
</div>
<!-- =======What does the Genome Browser do?======= -->
<a name="What"></a>
<h2>What does the Genome Browser do?</h2>
<p>
As vertebrate genome sequences near completion and research re-focuses on their analysis, the issue
of effective sequence display becomes critical: it is not helpful to have 3 billion letters of
genomic DNA shown as plain text! As an alternative, the UCSC Genome Browser provides a rapid and
reliable display of any requested portion of genomes at any scale, together with dozens of aligned
annotation tracks (known genes, predicted genes, ESTs, mRNAs, CpG islands, assembly gaps and
coverage, chromosomal bands, mouse homologies, and more). Half of the annotation tracks are computed
at UCSC from publicly available sequence data. The remaining tracks are provided by collaborators
worldwide. Users can also add their own custom tracks to the browser for educational or research
purposes.</p>
<p>
The Genome Browser stacks annotation tracks beneath genome coordinate positions, allowing rapid
visual correlation of different types of information. The user can look at a whole chromosome to
get a feel for gene density, open a specific cytogenetic band to see a positionally mapped disease
gene candidate, or zoom in to a particular gene to view its spliced ESTs and possible alternative
splicing. The Genome Browser itself does not draw conclusions; rather, it collates all relevant
information in one location, leaving the exploration and interpretation to the user.</p>
<p>
The Genome Browser supports text and sequence based searches that provide quick, precise access to
any region of specific interest. Secondary links from individual entries within annotation tracks
lead to sequence details and supplementary off-site databases. To control information overload,
tracks need not be displayed in full. Tracks can be hidden, collapsed into a condensed or
single-line display, or filtered according to the user's criteria. Zooming and scrolling controls
help to narrow or broaden the displayed chromosomal range to focus on the exact region of interest.
Clicking on an individual item within a track opens a details page containing a summary of
properties and links to off-site repositories such as PubMed, GenBank, Entrez, and OMIM. The page
provides item-specific information on position, cytoband, strand, data source, and encoded protein,
mRNA, genomic sequence and alignment, as appropriate to the nature of the track.</p>
<p>
A blue navigation bar at the top of the browser provides links to several other tools and data
sources. For instance, under the "View" menu, the "DNA" link enables the user
to view the raw genomic DNA sequence for the coordinate range displayed in the browser window. This
DNA can encode track features via elaborate text formatting options. Other links tie the Genome
Browser to the BLAT alignment tool, provide access to the underlying relational database via the
Table Browser, convert coordinates across different assembly dates, and open the window at the
complementary <a href="http://www.ensembl.org/" target="_blank">Ensembl</a> or
<a href="https://www.ncbi.nlm.nih.gov/genome/gdv/" target="_blank">NCBI Genome Data Viewer</a> annotation.</p>
<p>
The browser data represents an immense <a href="../credits.html">collaborative effort</a> involving
thousands of people from the international biomedical research community. The UCSC Bioinformatics
Group itself does no sequencing. Although it creates the majority of the annotation tracks in-house,
the annotations are based on publicly available data contributed by many labs and research groups
throughout the world. Several of the Genome Browser annotations are generated in collaboration with
outside individuals or are contributed wholly by external research groups. UCSC's other major roles
include building genome assemblies, creating the Genome Browser work environment, and serving it
online. The majority of the sequence data, annotation tracks, and even software are in the public
domain and are available for anyone to <a href="#Download">download</a>.</p>
<p>
In addition to the Genome Browser, the UCSC Genome Bioinformatics group provides several other tools
for viewing and interpreting genome data:
<ul>
<li>
<a href="../../cgi-bin/hgBlat?command=start">BLAT</a> - a fast sequence-alignment tool similar
to BLAST. <a href="#BLATAlign">Read more</a>.</li>
<li>
<a href="../../cgi-bin/hgTables">Table Browser</a> - convenient text-based access to the
database underlying the Genome Browser. <a href="hgTablesHelp.html">Read more</a>.</li>
<li>
<a href="../../cgi-bin/hgGenome">Genome Graphs</a> - a tool that allows you to upload and display
genome-wide data sets such as the results of genome-wide SNP association studies, linkage studies
and homozygosity mapping. <a href="hgGenomeHelp.html">Read more</a>.</li>
<li>
<a href="../../cgi-bin/hgNear">Gene Sorter</a> - expression, homology, and other information on
groups of genes that can be related in many ways. <a href="hgNearHelp.html">Read more</a>.</li>
</ul>
<!-- =======Getting Started: Genome Browser gateway======= -->
<a name="GetStarted"></a>
<h2>Getting started: Genome Browser gateway</h2>
<p>
The UCSC Genome Bioinformatics <a href="../../index.html" target="_blank">home page</a> provides
access to Genome Browsers on several different genome assemblies. To get started, click the Browser
link on the blue sidebar. This will take you to a Gateway page where you can select which genome to
display. Note that there are also official <a href="genomeEuro.html">mirror sites</a> in Europe and
Asia for users who are geographically closer to those continents than to the western United
States.</p>
<h6>Opening the Genome Browser at a specific position</h6>
<p>
To get oriented in using the Genome Browser, try viewing a gene or region of the genome with which
you are already familiar, or use the default position. To open the Genome Browser window:</p>
<ol>
<li>
Select the clade, genome and assembly that you wish to display from the corresponding pull-down
menus. Assemblies are typically named by the first three characters of an organism's genus and
species names. For older assemblies that are no longer available from the menu, the data may still
be available on our <a href="http://hgdownload.soe.ucsc.edu/downloads.html"
target="_blank">Downloads</a> page.</li>
<li>
Specify the genome location you'd like the Genome Browser to open to. To select a location, enter
a valid position query in the <em>search term</em> text box at the top of the Gateway page or
accept the default position already displayed. The search supports several different types of
<a href="query.html">queries</a>: gene symbols, mRNA or EST accession numbers, chromosome bands,
descriptive terms likely to occur in GenBank text, or specific chromosomal ranges.</li>
<li>
Click the <em>submit</em> button to open up the Genome Browser window to the requested location.
In cases where a specific term (accession, gene name, etc.) was queried, the item will be
highlighted in the display.</li>
</ol>
<p>
Occasionally the Gateway page returns a list of several matches in response to a search, rather than
immediately displaying the Genome Browser window. When this occurs, click on the item in which
you're interested and the Genome Browser will open to that location.</p>
<p>
The search mechanism is not a site-wide search engine. Instead, it primarily searches GenBank mRNA
records whose text annotations can include gene names, gene symbols, journal title words, author
names, and RefSeq mRNAs. Searches on other selected identifiers, such as NP and NM accession
numbers, OMIM identifiers, and Entrez Gene IDs are supported. However, some types of queries will
return an error, e.g. post-assembly GenBank entries, withdrawn gene names, and abandoned synonyms.
If your initial query is unsuccessful, try entering a different related term that may produce the
same location. For example, if a query on a gene symbol produces no results, try entering an mRNA
accession, gene ID number, or descriptive words associated with the gene.</p>
<p><iframe width="560" height="315" src="https://www.youtube.com/embed/5zc9sqd4SD4?rel=0"
frameborder="0" allow="accelerometer; autoplay; encrypted-media; gyroscope; picture-in-picture"
allowfullscreen></iframe></p>
<h6>Finding a genome location using BLAT</h6>
<p>
If you have genomic, mRNA, or protein sequence, but don't know the name or the location to which it
maps in the genome, the <a href="../../cgi-bin/hgBlat">BLAT</a> tool will rapidly locate the
position by homology alignment, provided that the region has been sequenced. This search will find
close members of the gene family, as well as assembly duplication artifacts. An entire set of query
sequences can be looked up simultaneously when provided in fasta format.</p>
<p>
A successful BLAT search returns a list of one or more genome locations that match the input
sequence. To view one of the alignments in the Genome Browser, click the <em>browser</em> link for
the match. The <em>details</em> link can be used to preview the alignment to determine if it is of
sufficient match quality to merit viewing in the Genome Browser. If too many BLAT hits occur, try
narrowing the search by filtering the sequence in slow mode with
<a href="http://www.repeatmasker.org" target="_blank">RepeatMasker</a>, then rerunning the BLAT
search.</p>
<p>
For more information on conducting and fine-tuning BLAT searches, refer to the
<a href="#BLATAlign">BLAT section</a> of this document.</p>
<h6>Opening the Genome Browser with a custom annotation track</h6>
<p>
You can open the Genome Browser window with a custom annotation track displayed by using the Add
Custom Tracks feature available from the gateway and annotation tracks pages. For more information
on creating and using custom annotation tracks, refer to the <a href="#CustomTracks">Creating
custom annotation tracks</a> section.</p>
<p>
Annotation track data can be entered in one of three ways:</p>
<ul>
<li>
Enter the file name for an annotation track source file in the Annotation File text box.</li>
<li>
Type or paste the annotation track data into the large text box.</li>
<li>
If the annotation data are accessible through a URL, enter the URL name in the large text
box.</li>
</ul>
<p>
Once you've entered the annotation information, click the <em>submit</em> button at the top of
the Gateway page to open up the Genome Browser with the annotation track displayed.</p>
<p>
The Genome Browser also provides a <a href="../customTracks/custTracks.html"
target="_blank">collection of custom annotation tracks</a> contributed by the UCSC Genome
Bioinformatics group and the research community.</p>
<p>
<strong>NOTE:</strong> If an annotation track does not display correctly when you attempt to upload
it, you may need to reset the Genome Browser to its default settings, then reload the track. For
information on troubleshooting display problems with custom annotation tracks, refer to the
troubleshooting section in the <a href="#CustomTracks">Creating custom annotation tracks</a>
section.</p>
<h6>Viewing genome data as text</h6>
<p>
The <a href="../../cgi-bin/hgTables" target="_blank">Table Browser</a>, a portal to the underlying
open source <a href="http://www.mariadb.org" target="_blank">MariaDB</a> relational database driving the
Genome Browser, displays genomic data as columns of text rather than as graphical tracks. For more
information on using the Table Browser, see the section <a href="#TableBrowser">Getting started: on
the Table Browser</a>.</p>
<h6>Opening the Genome Browser from external gateways</h6>
<p>
Several external gateways provide direct links into the Genome Browser. Examples include:
<a href="https://www.ncbi.nlm.nih.gov/entrez/" target="_blank">Entrez Gene</a>,
<a href="https://www.ncbi.nlm.nih.gov/IEB/Research/Acembly/index.html" target="_blank">AceView</a>,
<a href="http://www.ensembl.org/" target="_blank">Ensembl</a>,
<a href="http://supfam.mrc-lmb.cam.ac.uk/SUPERFAMILY/" target="_blank">SuperFamily</a>, and
<a href="http://www.genecards.org/" target="_blank">GeneCards</a>. Journal articles can also link
to the browser and provide custom tracks. Be sure to use the assembly date appropriate to the
provided coordinates when using data from a journal source.</p>
<h6>Tips for Use</h6>
<p>
To facilitate your return to regions of interest within the Genome Browser, save the coordinate
range or bookmark the page of displays that you plan to revisit or wish to share with others.</p>
<p>
It is usually best to work with the most recent assembly even though a full set of tracks might not
yet be ready. Be aware that the coordinates of a given feature on an unfinished chromosome may
change from one assembly to the next as gaps are filled, artifactual duplications are reduced, and
strand orientations are corrected. The Genome Browser offers multiple tools that can correctly
convert coordinates between different assembly releases. For more information on conversion tools,
see the section <a href="#Convert">Converting data between assemblies</a>.</p>
<p>
To ensure uninterrupted browser services for your research during UCSC server maintenance and power
outages, bookmark a <a href="../../mirror.html" target="_blank">mirror</a> site that replicates the
UCSC genome browser.</p>
<p>
Bear in mind that the Genome Browser cannot outperform the underlying quality of the draft genome.
Assembly errors and sequence gaps may still occur well into the sequencing process due to regions
that are intrinsically difficult to sequence. Artifactual duplications arise as unavoidable
compromises during a build, causing misleading matches in genome coordinates found by alignment.</p>
<!-- =======Interpreting and configuring the Genome Browser ======= -->
<a name="FineTuning"></a>
<h2>Interpreting and fine-tuning the Genome Browser display</h2>
<p>
The Genome Browser annotation tracks page displays a genome location specified through a Gateway
search, a BLAT search, or an uploaded custom annotation track. There are five main features on this
page: a set of <a href="#NAV">navigation controls</a>, a chromosome ideogram, the annotations tracks
image, <a href="#TRACK_CONFIG">display configuration buttons</a>, and a set of track
<a href="#TRACK_CONT">display controls</a>.</p>
<p>
The first time you open the Genome Browser, it will use the application default values to configure
the annotation tracks display. By manipulating the navigation, configuration and display controls,
you can customize the annotation tracks display to suit your needs. For a complete description of
the annotation tracks available in all assembly versions supported by the Genome Browser, see the
<a href="#IndivTracks"> Annotation Track Descriptions</a> section.</p>
<p>
The Genome Browser retains user preferences from session to session within the same web browser,
although it never monitors or records user activities or submitted data. To restore the default
settings, click the "Reset All User Settings" under the top blue Genome Browser menu. To
return the display to the default set of tracks (but retain custom tracks and other configured
Genome Browser settings), click the <em>default tracks</em> button on the Genome Browser page.</p>
<h3>Annotation track display conventions</h3>
<p>
<strong>Annotation track descriptions:</strong> Each annotation track has an associated
description page that contains a discussion of the track, the methods used to create the
annotation, the data sources and credits for the track, and (in some cases) filter and
configuration options to fine-tune the information displayed in the track. To view the description
page, click on the mini-button to the left of a displayed track or on the label for the track in
the Track Controls section.</p>
<p>
<strong>Annotation track details pages:</strong> When an annotation track is displayed in full,
pack, or squish mode, each line item within the track has an associated details page that can be
displayed by clicking on the item or its label. The information contained in the details page
varies by annotation track, but may include basic position information about the item, related
links to outside sites and databases, links to genomic alignments, or links to corresponding mRNA,
genomic, and protein sequences.</p>
<p>
<a name="GeneDisplay"></a><strong>Gene prediction tracks:</strong> Coding exons are represented by
blocks connected by horizontal lines representing introns. The 5' and 3' untranslated regions
(UTRs) are displayed as thinner blocks on the leading and trailing ends of the aligning regions.
In full display mode, arrowheads on the connecting intron lines indicate the direction of
transcription. In situations where no intron is visible (e.g. single-exon genes, extremely
zoomed-in displays), the arrowheads are displayed on the exon block itself.</p>
<p>
<a name="PSLDisplay"></a><strong>Pattern Space Layout (PSL) alignment tracks:</strong> Aligning
regions (usually exons when the query is cDNA) are shown as black blocks. In dense display mode,
the degree of darkness corresponds to the number of features aligning to the region or the degree
of quality of the match. In pack or full display mode, the aligning regions are connected by lines
representing gaps in the alignment (typically spliced-out introns), with arrowheads indicating
the orientation of the alignment, pointing right if the query sequence was aligned to the forward
strand of the genome and left if aligned to the reverse strand. Two parallel lines are drawn over
double-sided alignment gaps, which skip over unalignable sequence in both target and query. For
alignments of ESTs, the arrows may be reversed to show the apparent direction of transcription
deduced from splice junction sequences. In situations where no gap lines are visible, the
arrowheads are displayed on the block itself. To prevent display problems, the Genome Browser
imposes an upper limit on the number of alignments that can be viewed simultaneously within the
tracks image. When this limit is exceeded, the Browser displays the best several hundred
alignments in a condensed display mode, then lists the number of undisplayed alignments in the
last row of the track. In this situation, try zooming in to display more entries or to return the
track to full display mode. For some PSL tracks, <a href="hgCodonColoringMrna.html">extra
coloring</a> to indicate mismatching bases and query-only gaps may be available.</p>
<p>
<a name="ChainDisplay"></a><strong>Chain tracks (2-species alignment):</strong> Chain tracks
display boxes joined together by either single or double lines. The boxes represent aligning
regions. Single lines indicate gaps that are largely due to a deletion in the genome of the first
species or an insertion in the genome of the second species. Double lines represent more complex
gaps that involve substantial sequence in both species. This may result from inversions,
overlapping deletions, an abundance of local mutation, or an unsequenced gap in one species. In
cases where there are multiple chains over a particular portion of the genome, chains with
single-lined gaps are often due to processed pseudogenes, while chains with double-lined gaps are
more often due to paralogs and unprocessed pseudogenes. In the fuller display modes, the
individual feature names indicate the chromosome, strand, and location (in thousands) of the match
for each matching alignment.</p>
<p>
<a name="NetDisplay"></a><strong>Net tracks (2-species alignment):</strong> Boxes represent
ungapped alignments, while lines represent gaps. Clicking on a box displays detailed information
about the chain as a whole, while clicking on a line shows information on the gap. The detailed
information is useful in determining the cause of the gap or, for lower level chains, the genomic
rearrangement. Individual items in the display are categorized as one of four types (other than
gap):</p>
<ul>
<li>
<em>Top</em> - The best, longest match. Displayed on level 1.</li>
<li>
<em>Syn</em> - Lineups on the same chromosome as the gap in the level above it.</li>
<li>
<em>Inv</em> - A lineup on the same chromosome as the gap above it, but in the opposite
orientation.</li>
<li>
<em>NonSyn</em> - A match to a chromosome different from the gap in the level above.</li>
</ul>
<p>
<a name="SnakeDisplay"></a><strong>Snake tracks:</strong> The snake alignment track (or snake
track) shows the relationship between the chosen Browser genome (reference genome) and another
genome (query genome). A snake is a way of viewing a set of pairwise gapless alignments that may
overlap on both the reference and query genomes. Alignments are always represented as being on the
positive strand of the reference species, but can be on either strand on the query sequence.</p>
<p>
In full display mode, a snake track can be decomposed into two drawing elements: segments (colored
rectangles) and adjacencies (lines connecting the segments). Segments represent subsequences of
the target genome aligned to the given portion of the reference genome. Adjacencies represent the
covalent bonds between the aligned subsequences of the target genome.</p>
<p>
Red tick-marks within segments represent substitutions with respect to the reference, shown in
windows of the reference of (by default) up to 50 Kb. Zoomed in to the base level, these
substitutions are labeled with the non-reference base.</p>
<p>
An insertion in the reference relative to the query creates a gap between abutting segment sides
that is connected by an adjacency. An insertion in the query relative to the reference is
represented by an orange tick-mark that splits a segment at the location the extra bases would be
inserted. Simultaneous independent insertions in both query and reference look like an insertion
in the reference relative to the target, except that the corresponding adjacency connecting the
two segments is colored orange. More complex structural rearrangements create adjacencies that
connect the sides of non-abutting segments in a natural fashion.</p>
<p>
Pack mode can be used to display a larger number of snake tracks in the limited vertical browser.
This mode eliminates the adjacencies from the display and forces the segments onto as few rows as
possible, given the constraint of still showing duplications in the query sequence.</p>
<p>
Dense mode further eliminates these duplications so that each snake track is compactly represented
along just one row.</p>
<p>
<strong>Wiggle tracks:</strong> These tracks plot a continuous function along a chromosome. Data
is displayed in windows of a set number of base pairs in width. The score for each window displays
as "mountain ranges" The display characteristics vary among the tracks in this group.
See the individual track descriptions for more information on interpreting the display. If the
peak is taller or shorter than what can be shown in the display, it is clipped and colored
magenta.</p>
<a name="TRACK_CONT"></a>
<h3>Annotation track display modes</h3>
<p>
Each annotation track within the window may have up to five display modes:
<p>
<ul class="gbsNoBullet">
<li>
<strong>Hide:</strong> the track is not displayed at all. To hide all the annotation tracks, click
the <em>hide all</em> button. This mode is useful for restricting the display to only those tracks
in which you are interested. For example, someone who is not interested in SNPs or mouse synteny
may want to hide these tracks to reduce track clutter and improve speed. There are a few
annotation tracks that pertain only to one specific chromosome, e.g. Sanger22, Rosetta. In these
cases, the track and its associated controller will be hidden automatically when the track window
is not open to the relevant chromosome.</li>
<li>
<strong>Dense:</strong> the track is displayed with all features collapsed into a single line.
This mode is useful for reducing the amount of space used by a track when you don't need
individual line item details or when you just want to get an overall view of an annotation. For
example, by opening an entire chromosome and setting the RefSeq Genes track to dense, you can get
a feel for the known gene density of the chromosome without displaying excessive detail. <br>
<img src="../../images/dense14_800_gc29.png" width="800px">
</li>
<li>
<strong>Full:</strong> the track is displayed with each annotation feature on a separate line. It
is recommended that you use this option sparingly, due to the large number of individual track
items that may potentially align at the selected position. For example, hundreds of ESTs might
align with a specified gene. When the number of lines within a requested track location exceeds
250, the track automatically defaults to a more tightly-packed display mode. In this situation,
you can restore the track display to full mode by narrowing the chromosomal range displayed or by
using a track filter to reduce the number of items displayed. On tracks that contain only hide,
dense, and full modes, you can toggle between full and dense display modes by clicking on the
track's center label.<br>
<img src="../../images/full14_800_gc29-1.png" width="800px">
</li>
<li>
<strong>Squish:</strong> the track is displayed with each annotation feature shown separately, but
at 50% the height of full mode. Features are unlabeled, and more than one may be drawn on the same
line. This mode is useful for reducing the amount of space used by a track when you want to view a
large number of individual features and get an overall view of an annotation. It is particularly
good for displaying tracks in which a large number of features align to a particular section of a
chromosome, e.g. EST tracks.<br>
<img src="../../images/squish14_800_gc29-1.png" width="800px">
</li>
<li>
<strong>Pack:</strong> the track is displayed with each annotation feature shown separately and
labeled, but not necessarily displayed on a separate line. This mode is useful for reducing the
amount of space used by a track when you want to view the large number of individual features
allowed by squish mode, but need the labeling and display size provided by full mode. When the
number of lines within the requested track location exceeds 250, the track automatically defaults
to squish display mode. In this situation, you can restore the track display to pack mode by
narrowing the chromosomal range displayed or by using a track filter to reduce the number of items
displayed. To toggle between pack and full display modes, click on the track's center label.<br>
<img src="../../images/pack14_800_gc29-1.png" width="800px" >
</li>
</ul>
<p>
The track display controls are grouped into categories that reflect the type of data in the track,
e.g., Gene Prediction Tracks, mRNA and EST tracks, etc. To change the display mode for a track, find
the track's controller in the Track Controls section at the bottom of the Genome Browser page,
select the desired mode from the control's display menu, and then click the <em>refresh</em> button.
Alternatively, you can change the display mode by using the Genome Browser's
<a href="#RIGHT_CLICK_NAV">right-click navigation</a> feature, or can toggle between dense and full
modes for a displayed track (or pack mode when available) by clicking on the optional center label
for the track.</p>
<a name="duplicate"></a>
<h3>Duplicating a track</h3>
<p>
Tracks that are not inside of composite or supertracks can be duplicated to allow for independent
track settings for a track. To duplicate a track, go to the track settings page for the track and
there will be a link, "Duplicate track", next to the Display mode setting:</p>
<p class="text-center"><img src="/images/duplicateDisplay.png"></p>
<p>
Clicking the link will take you to the new track
settings page for the duplicate track with the additional text, "(duplicate #1)". This number
will increment by one for each additional copy of the track. After creating the copy, a
"Remove duplicate" link will also appear on the track settings page for when you wish to
remove the duplicated track. As an example, duplicating the GENCODE track on hg38 allows users to
have two tracks, one in 'squish' mode and a second track in 'full' mode as a 'density graph'.</p>
<div class="row">
<div class="col-md-6">
<p class="text-center"><img src="/images/duplicateTrackUi_GENCODEV43.png" width="550px"></p>
</div>
<div class="col-md-6">
<p class="text-center"><img src="/images/removeDuplicateTrackUi_GENCODEV43.png" width="550px"></p>
</div>
</div>
<p>
Each copy of the track will have it's
own independent settings to allow for multiple display views without having to revert back to an
alternate view for the dataset.</p>
<p class="text-center">
<img src="/images/duplicationHgTracks_GENCODEV43.png" width="800px">
</p>
<h3>Changing the display mode for a group of tracks</h3>
<p>
Track display modes may be set individually or as a group on the Genome Browser Track Configuration
page. To access the configuration page, click the <em>configure</em> button on the annotation tracks
page or the <em>configure tracks and display</em> button on the Gateway page. Exercise caution when
using the <em>show all</em> buttons on track groups or assemblies that contain a large number
tracks; this may seriously impact the display performance of the Genome Browser or cause your
Internet browser to time out.</p>
<h3>Hiding the track display controls</h3>
<p>
The entire set of track display controls at the bottom of the annotation tracks page may be hidden
from view by checking the <em>Show track controls under main graphic</em> option in the Configure
Image section of the Track Configuration page.</p>
<h3>Changing the display of a track by using filters and configuration options</h3>
<p>
Some tracks have additional filter and configuration capabilities, e.g., EST tracks, mRNA tracks,
NC160, etc. These options let the user modify the color or restrict the data displayed within an
annotation track. Filters are useful for focusing attention on items relevant to the current task in
tracks that contain large amounts of data. For example, to highlight ESTs expressed in the liver,
set the EST track filter to display items in a different color when the associated tissue keyword is
"liver" Configuration options let the user adjust the display to best show the data of
interest. For example, the min vertical viewing range value on wiggle tracks can be used to
establish a data threshold. By setting the min value to "50", only data values greater
than 50 percent will display.</p>
<p>
To access filter and configuration options for a specific annotation track, open the track's
description page by clicking the label for the track's control menu under the Track Controls
section, the mini-button to the left of the displayed track, or the "Configure..." option
from the Genome Browser's <a href="#RIGHT_CLICK_NAV">right-click</a> popup menu. The filter and
configration section is located at the top of the description page. In most instances, more
information about the configuration options is available within the description text or through a
special help link located in the configuration section.</p>
<p>
Filter and configuration settings are persistent from session to session on the same web browser.
To return the Genome Browser display to the default set of tracks (but retain custom tracks and
other configured Genome Browser settings), click the <em>default tracks</em> button on the Genome
Browser tracks page. To remove all user configuration settings and custom tracks, and completely
restore the defaults, click the "Reset All User Settings" under the top blue Genome
Browser menu.</p>
<h3> Video tutorial on changing track display modes</h3>
<p><iframe width="560" height="315" src="https://www.youtube.com/embed/jKix2B3hwnw?rel=0"
frameborder="0" allow="accelerometer; autoplay; encrypted-media; gyroscope; picture-in-picture"
allowfullscreen></iframe></p>
<a name="NAV"></a>
<h3>Zooming and scrolling the tracks display</h3>
<p>
At times you may want to adjust the amount of flanking region displayed in the annotation tracks
window or adjust the scale of the display. At a scale of 1 pixel per base pair, the window
accurately displays the width of exons and introns, and indicates the direction of transcription
(using arrowheads) for multi-exon features. At a grosser scale, certain features - such as thin
exons - may disappear. Also, some exons may falsely appear to fall within RepeatMasker features at
some scales.</p>
<p>
Click the <em>zoom in</em> and <em>zoom out</em> buttons at the top of the Genome Browser page to
zoom in or out on the center of the annotation tracks window by 1.5, 3 or 10-fold. Alternatively,
you can zoom in 3-fold on the display by clicking anywhere on the Base Position track. In this case,
the zoom is centered on the coordinate of the mouse click. To view the base composition of the
sequence underlying the current annotation track display, click the <em>base</em> button.</p>
<p>
Quickly zoom to a specific region of interest by using the browser's "drag-and-select"
feature. To define the region you wish to zoom to, click and hold the mouse button on one edge of
the desired zoom area in the Base Position track, drag the mouse right or left to highlight the
selection area, then release the mouse button. A "drag-and-select" popup will appear.
Click on the "Zoom In" button to zoom in on the selected region. To disable the
drag-and-select popup, check the "Don't show this dialog again and always zoom" checkbox.
To drag-and-select (zoom) on a part of the image other than the Base Position track, depress the
shift key before clicking and dragging the mouse. Note that the <em>Enable advanced javascript
features</em> option on the Track Configuration page must be toggled on to use this feature.</p>
<p>
To scroll (pan) the view of the entire tracks image horizontally, click on the image and drag the
cursor to the left or right, then release the mouse button, to shift the displayed region in the
corresponding direction. The view may be scrolled by up to one image width. To scroll the annotation
tracks horizontally by set increments of 10%, 50%, or 95% of the displayed size (as given in base
pairs), click the corresponding <em>move</em> arrow. It is also possible to scroll the left or right
side of the tracks by a specified number of vertical gridlines while keeping the position of the
opposite side fixed. To do this, click the appropriate <em>move start</em> or <em>move end</em>
arrow, located under the annotation tracks window. For example, to keep the left-hand display
coordinate fixed but increase the right-hand coordinate, you would click the right-hand <em>move
end</em> arrow. To increase or decrease the gridline scroll interval, edit the value in the
<em>move start</em> or <em>move end</em> text box.</p>
<a name="Highlight"></a>
<h3>Highlighting a region</h3>
<p>
The browser's "drag-and-select" pop-up menu provides options to add single or
multiple vertical highlights to selected regions, as described below:</p>
<p>
Main features in drag-and-select menu:</p>
<ul>
<li>
Use shift+drag or click-drag to enable the "drag-and-select"
dialog box menu.</li>
<li>
In the menu, a checkbox controls behavior for drag-and-select; you
can hide the menu and always zoom with shift+select. If selected, re-enable
via 'View - Configure Browser' (keyboard shortcut: c then f).</li>
<li>
A "color picker" option allows for easy color selection of each highlight;
you can also create multiple highlights (each with various colors if
desired).</li>
<li>
Hold Shift+drag to show the menu (or click+drag).</li>
<li>
Hold Alt+drag to add a highlight (without displaying the menu).</li>
<li>
Hold Ctrl+drag (Windows) or Cmd+drag (Mac) to zoom (without displaying the
menu).</li>
<li>
To cancel, press Esc anytime or drag mouse outside image.</li>
<li>
Highlight the current position with the keyboard shortcut "h then
m."</li>
<li>
Clear all highlights with View - Clear Highlights (or keyboard shortcut
h then c), or simply right-click on a highlight to remove all highlights.</li>
</ul>
<p>
In the genome browser, there are also options for right-clicking:</p>
<ul>
<li>
Remove highlighting</li>
<li>
Zoom in to a highlighted region</li>
</li>
<li>
Highlight a gene - right-click on the gene (e.g., SOD1) and select
"Highlight SOD1"</li>
</ul>
<h3>Changing the displayed track position</h3>
<p>
To display a completely different position in the genome, enter the new query in the
<em>position/search</em> text box, then click the <em>jump</em> button. For more information on
valid entries for this text box, refer to the <a href="#GetStarted">Getting started</a> section.</p>
<p>
If a chromosome image (ideogram) is available above the track display, click anywhere on the
chromosome to move to that position (the current window size will be maintained). Select a region
of any size by clicking and dragging in the image. Finally, hold the "control" key while
clicking on a chromosome band to select the entire band.</p>
<h3>Changing the order of the displayed tracks</h3>
<p>
To vertically reposition a track in the annotation track window, click-and-hold the mouse button on
the side label, then drag the highlighted track up or down within the image. Release the mouse
button when the track is in the desired position. To move an entire group of associated tracks (such
as all the displayed subtracks in a composite track), click-and-hold the gray mini-button to the
left of the tracks, then drag.</p>
<a name="TRACK_CONFIG"></a>
<h3>Viewing multiple regions</h3>
<p>
To remove intronic or intergenic regions from the display or to view only custom specified regions,
click the <em>multi-region</em> button under the track image. For human assemblies hg17 and later,
you may also replace a section of the reference genome with an alternate haplotype chromosome in
order to view annotations upstream and downstream of the sequence. For more information about the
multi-region feature see the <a href="./multiRegionHelp.html">multi-region help</a> page.</p>
<h3 id="config">Configuration panel</h3>
<div class="text-center">
<a href ="/cgi-bin/hgTracks?hgTracksConfigPage=configure">
<img src="../../images/configureMenu.png" alt="Configuration menu options" width="700">
</a>
</div>
<h4>Changing the width of the annotation track window</h4>
<p>
The first time the annotation track window is displayed, or after the Genome Browser has been reset,
the size of the track window is set by default to the width that best fits your Internet browser
window. If you horizontally resize the browser window, you can automatically adjust the annotation
track image size to the new width by clicking the <em>resize</em> button under the track image. To
manually override the default width, enter a new value in the <em>image width</em> text box on the
Track Configuration page, then click the <em>submit</em> button. The maximum supported width is 5000
pixels.</p>
<h4>Changing the width of the label area to the left of the image</h4>
<p>
The item labels (or track label, when viewed in dense mode) are displayed to the left of the
annotation image. The width of this area is set to 17 characters by default. To change the width,
edit the value in the <em>label area width</em> text box on the Track Configuration page, then click
<em>Submit</em>.</p>
<h4>Changing the text size, font, in the annotation track image</h4>
<p>
The annotation track image may be adjusted to display text in a range of fonts from
AvantGarde, Courier, and Times. To change the size of the text, select an option from
the <em>text size</em> pull-down menu on the Browser Configuration page, which you can
find under the top blue "Genome Browser" menu by clicking <a target="_blank"
href="/cgi-bin/hgTracks?hgTracksConfigPage=configure"><em>Configure</em></a>.
Once you have made your selection, which can also include <em>style</em> click <em>submit</em>.
The text size is set to "12" and "Helvetica" by default.</p>
<h4>Hiding the chromosome ideogram</h4>
<p>
The chromosome ideogram, located just above the annotation tracks image, provides a graphical
overview of the features on the selected chromosome, including its bands, the position of the
centromere, and an indication of the region currently displayed in the annotation tracks image. To
hide the ideogram, uncheck the <em>Display chromosome ideogram above main graphic</em> box on the
Tracks Configuration page.</p>
<h4>Hiding the light blue vertical guidelines</h4>
<p>
The light blue vertical guidelines on the annotation tracks image may be removed by unchecking the
<em>Show light blue vertical guidelines</em> box on the Track Configuration page.</p>
<h4>Hiding the annotation track labels and description</h4>
<p>
The track and element labels displayed above and to the left of the tracks in the annotation tracks
image may be hidden from view by unchecking the <em>Display track descriptions above each track</em>
and <em>Display labels to the left of items in tracks</em> boxes, respectively, on the Track
Configuration page.</p>
<h4 id="nextItem">Enabling next/previous item and exon navigation</h4>
<div class="text-center">
<a href ="/cgi-bin/hgTracks?db=hg38&position=chr10:67,881,992-67,890,592&hideTracks=1&knownGene=pack&omimAvSnp=pack&nextItemArrows=1">
<img src="../../images/nextItem.png" alt="Ex. white/gray arrows for next/previous exon/item" width="700"></a>
<p class="gbsCaption text-center">Gray arrows jump to the next item,
while white arrows advance to the next exon.</p>
</div>
<p>
When the <em>Next/previous item navigation</em> configuration option is toggled on, on the Track
Configuration page, gray double-headed arrows display in the Genome Browser tracks image on both
sides of the track labels of gene, mRNA and EST tracks (or any standard tracks based on BED, PSL or
genePred format). Clicking on the gray arrows shifts the image window toward that end of the
chromosome so that the next item in the track is displayed. Similarly, the <em>Next/previous exon
navigation</em> configuration option displays white double-headed arrows on the end of any item that
extends off the edge of the current image. Clicking on one of the white arrows shifts the image
window to the next exon in the indicated direction, unless the image window interrupts an exon, in
which case the window shifts to the edge of the current exon. If the image window happens to be
within a 5' or 3' UTR, then clicking the arrows shifts the image window towards the start or end of
the next coding region, not the end of the exon.</p>
<a name="RIGHT_CLICK_NAV"></a>
<h3>Using the right-click navigation feature</h3>
<p>
Several of the common display and navigation operations offered on the Genome Browser tracks page
may be quickly accessed by right-clicking on a feature on the tracks image and selecting an option
from the displayed popup menu.</p>
<div class="text-center">
<a target="_blank" href="/cgi-bin/hgTracks?db=hg38&position=chr21%3A31657975-31667213&hgt.reset=1&hgFind.matches=ENST00000270142.11&knownGene.show.noncoding=0&knownGene.show.spliceVariants=0">
<img src="../../images/right_click_example.png" alt="Example right-click to highlight a gene" width="700">
</a>
</div>
<p>
Depending on context, the right-click feature allows the user
to:</p>
<ul>
<li>
change the track display mode</li>
<li>
zoom in or out to the exact position coordinates of the feature</li>
<li>
highlight the feature</li>
<li>
open the "Get DNA for..." link for the feature's coordinates</li>
<li>
display details about the feature </li>
<li>
open a popup window to configure the track's display of the feature</li>
<li>
display the entire tracks image in a separate window for inclusion in spreadsheets or other
documents. The Genome Browser <a href="#print">PDF</a> option under the View menu
can also be used to generate a high-quality annotation tracks image suitable for printing.</li>
</ul>
<p>
To use the right-click feature, make sure your internet browser allows the display of
popup windows from genome.ucsc.edu. When enabled, the right-click navigation feature replaces the
default contextual popup menu typically displayed by the Internet browser when a user right-clicks
on the tracks image. A few combinations of the Mozilla Firefox browser on Mac OS do not support the
right-click menu functionality using secondary click; in these instances, ctrl+left-click must be
used to display the menu.</p>
<h3 id="print">Printing a copy of the annotation track window</h3>
<p>
The Genome Browser provides a mechanism for saving a copy of the currently displayed annotation
tracks image to a PDF file that can be printed or edited by drawing programs such as Adobe
Illustrator or Inkscape. This is useful for generating figures intended for publication.</p>
<p>
To print or save the image to a file:
<ol>
<li>
In the blue navigation bar at the top of the screen, from the "View" menu, click the
"PDF" link.</li>
<li>
Click one of the PDF links.</li>
</ol>
<p>
NOTE: If you have configured your browser image to use one of the larger font sizes, the text in the
resulting screen shot may not display correctly. If you encounter this problem, reduce the Genome
Browser font size using the <a href="#TRACK_CONFIG">Configuration utility</a>, then repeat the
save/print process.</p>
<!-- =======BLAT======= -->
<a name="BLATAlign"></a>
<h2>Using BLAT alignments</h2>
<p>
BLAT (BLAST-Like Alignment Tool) is a very fast sequence alignment tool similar to BLAST. For more
information on BLAT's internal scoring schemes and its overall n-mer alignment seed strategy, refer
to W. James Kent (2002) <a href="http://www.genome.org/cgi/content/abstract/12/4/656"
target="_blank">BLAT - The BLAST-Like Alignment Tool</a>, <em>Genome Res</em> 12:4 656-664.</p>
<p>
On DNA queries, BLAT is designed to quickly find sequences with 95% or greater similarity of length
25 bases or more. It may miss genomic alignments that are more divergent or shorter than these
minimums, although it will find perfect sequence matches of 32 bases and sometimes as few as 22
bases. The tool is capable of aligning sequences that contain large introns. On protein queries,
BLAT rapidly locates genomic sequences with 80% or greater similarity of length 20 amino acids or
more. In general, gene family members that arose within the last 350 million years can generally be
detected. More divergent sequences can be aligned to the human genome by using NCBI's BLAST and
psi-BLAST, then using BLAT to align the resulting match onto the UCSC genome assembly. In practice
DNA Blat works well on primates, and protein Blat works well on land vertebrates.</p>
<p>
Some common uses of BLAT include:</p>
<ul>
<li>
finding the genomic coordinates of mRNA or protein within a given assembly</li>
<li>
determining the exon structure of a gene</li>
<li>
displaying a coding region within a full-length gene</li>
<li>
isolating an EST of special interest as its own track</li>
<li>
searching for gene family members</li>
<li>
finding human homologs of a query from another species</li>
<li>
finding homologs of a query in all species hosted on the UCSC Genome Browser</li>
</ul>
<h3>Making a BLAT query</h3>
<p>
To locate a nucleotide or protein within a genome using BLAT:</p>
<ol>
<li>
Open the <a href="../../cgi-bin/hgBlat?command=start" target="_blank">BLAT Search Genome page</a>
by clicking on the "Tools" pulldown in the top blue menu bar of the Genome Browser.</li>
<li>
<b>Blat a single genome</b> – Select the genome, assembly, query type, output sort order, and
output type. To order the search
results based on the closeness of the sequence match, choose one of the score options in the
<em>Sort output</em> menu. The score is determined by the number of matches vs. mismatches in the
final alignment of the query to the genome. <br/>
<b>Blat ALL genomes</b> – The "Search ALL"
checkbox above the Genome drop-down list allows you to search
the genomes of the default assemblies for all of our organisms. This shows you an ordered list of
the default assemblies having the greatest similarity with your query sequence. Additionally, the
<em>Search ALL</em> feature searches any attached hubs' blat servers, meaning you can search
your user-generated assembly hubs. </li>
<li>
If the sequence to be uploaded is in an unformatted plain text file, enter the file name in the
<em>Upload sequence</em> text box, then click the <em>submit file</em> button. Otherwise, paste
the sequence or fasta-formatted list into the large edit box, and then click the <em>submit</em>
button. Input sequence can be obtained from the Genome Browser as well as from a custom annotation
track.</li>
</ol>
<p>
Header lines may be included in the input text if they are preceded by > and contain unique names.
Multiple sequences may be submitted at the same time if they are of the same type and are preceded
by unique header lines. Numbers, spaces, and extraneous characters are ignored:</p>
<pre><code>>sequence_1
ATGCAGAGCAAGGTGCTGCTGGCCGTCGCCCTGTGGCTCTGCGTGGAGAC
CCGGGCCGCCTCTGTGGGTTTGCCTAGTGTTTCTCTTGATCTGCCCAGGC
>sequence_2
ATGTTGTTTACCGTAAGCTGTAGTAAAATGAGCTCGATTGTTGACAGAGA
TGACAGTAGTATTTTTGATGGGTTGGTGGAAGAAGATGACAAGGACAAAG
>sequence_3
ATGCTGCGAACAGAGAGCTGCCGCCCCAGGTCGCCCGCCGGACAGGTGGC
CGCGGCGTCCCCGCTCCTGCTGCTGCTGCTGCTGCTCGCCTGGTGCGCGG
</code></pre>
<h3>BLAT limitations</h3>
<p>
DNA input sequences are limited to a maximum length of 25,000 bases. Protein or translated input
sequences must not exceed 10,000 letters. As many as 25 multiple sequences may be submitted at the
same time. The maximum combined length of DNA input for multiple sequence submissions is 50,000
bases (with a 25,000 base limit per individual sequence). For protein or translated input, the
maximum combined input length is 25,000 letters (with a 5000 letter limit per individual
sequence).</p>
<p>
NOTE: Program-driven BLAT use is limited to a maximum of one hit every 15 seconds and no more than
5000 hits per day.</p>
<h3>BLAT query search results</h3>
<p>
If a query returns successfully, BLAT will display a flat database file that summarizes the
alignments found. A BLAT query often generates multiple hits. This can happen when the genome
contains multiple copies of a sequence, paralogs, pseudogenes, statistical coincidences,
artifactual assembly duplications, or when the query itself contains repeats or common
retrotransposons. When too many hits occur, try resubmitting the query sequence after filtering in
slow mode with RepeatMasker.</p>
<p>
Items in the search results list are ordered by the criteria specified in the <em>Sort output</em>
menu. Each line item provides links to view the details of the sequence alignment or to open the
corresponding view in the Genome Browser. The <em>details</em> link gives the letter-by-letter
alignment of the sequence to the genome. It is recommended that you first examine the details of the
alignment for match quality before viewing the sequence in the Genome Browser.</p>
<p>
When several nearby BLAT matches occur on a single chromosome, a simple trick can be used to quickly
adjust the Genome Browser track window to display all of them: open the Genome Browser with the
match that has the lowest chromosome start coordinate, paste in the highest chromosome end
coordinate from the list of matches, then click the <em>jump</em> button.
<h3>Creating a custom annotation track from BLAT output</h3>
<p>
To make a custom track directly from BLAT, select the
<a href="../../FAQ/FAQformat.html#format2">PSL format</a> output option. The resulting PSL track can
be uploaded into the Genome Browser by pasting the data into the data text box on the Genome Browser
<a href="../../cgi-bin/hgCustom?">Add Custom Tracks</a> page, accessed via the "add custom
tracks" button on the Browser gateway and annotation tracks pages. See the
<a href="#CustomTracks">Creating custom annotation tracks</a> section for more information.</p>
<h3>Using BLAT for large batch jobs or commercial use</h3>
<p>
For large batch jobs or internal parameter changes, it is best to install command line BLAT on your
own Linux server. Sources and executables are free for academic, personal, and non-profit purposes.
BLAT source may be downloaded from <a href="https://genome-test.gi.ucsc.edu/~kent/src/"
target="_blank">https://genome-test.gi.ucsc.edu/~kent/src/</a>
(look for the <em>blatSrc*.zip</em> file with the
most recent date). For BLAT executables, go to <a href="http://genome-test.soe.ucsc.edu/~kent/exe/"
target="_blank">http://genome-test.soe.ucsc.edu/~kent/exe/</a>; binaries are sorted by platform.
Non-exclusive commercial licenses are available from the <a href="http://www.kentinformatics.com/"
target="_blank">Kent Informatics</a> website.</p>
<h3>BLAT documentation</h3>
<p>
For more information on the BLAT suite of programs, see the <a href="blatSpec.html">BLAT Program
Specifications</a> and the <a href="../../FAQ/FAQblat.html">Blat section</a> of the Genome
Browser FAQ.</p>
<a name="IndivTracks"></a>
<h2>Annotation track descriptions</h2>
<p>
Detailed information about an individual annotation track, including display characteristics,
configuration information, and associated database tables, may be obtained from the track
description page accessed by clicking the mini-button to the left of the displayed track in the
Genome Browser, or by selecting the "Open details..." or "Show details..."
option from the Genome Browser's <a href="#RIGHT_CLICK_NAV">right-click</a> menu. Click the
"View data format description" link on the track description page to display additional information
about the primary database table underlying the track. Data format information may also be accessed
via the "data format description" button in the <a href="#TableBrowser">Table Browser</a>.
For more information on configuring and using the tracks displayed in the Genome Browser track
window, see the section <a href="#FineTuning">Interpreting and Fine-tuning the Genome Browser
display</a>.</p>
<h3>Tips for viewing annotation track data</h3>
<ul>
<li>
To display a description page with more information about the track, click on the mini-button to
the left of a track.</li>
<li>
To display a details page with additional information about a specific line item within a track in
full display mode, click on the item or its label.</li>
<li>
A track does not appear in the browser if its display mode is set to <em>hide</em>. To restrict
the browser's display to only those tracks in which you're interested, set the display mode of the
unwanted tracks to <em>hide</em>.</li>
<li>
A track set to <em>full</em> display mode will default to a more tightly packed display mode if
the total number of lines in the track exceeds 250.</li>
<li>
To quickly toggle between <em>full</em> and <em>dense</em> or <em>pack</em> display modes, click
on the track's center label.</li>
<li>
Only the most recent assemblies are fully active. The data for older assemblies may be available
on our <a href="http://hgdownload.soe.ucsc.edu/downloads.html" target="_blank">Downloads</a>
page.</li>
<li>
Not all tracks appear in all assemblies. Only a basic set of tracks appears initially in a new
assembly.</li>
<li>
Track data can be viewed as text tables using the <a href="#TableBrowser">Table Browser</a>.</li>
<li>
<a href="../credits.html" target="_blank">Credit</a> goes to many individuals and institutions for
generously contributing the tracks. For specific information about the contributors of a given
track, look at the Credits section on a track's description page.</li>
</ul>
<a name="TableBrowser"></a>
<h2>Getting started on the Table Browser</h2>
<p>
The <a href="../../cgi-bin/hgTables" target="_blank">Table Browser</a> provides text-based access
to the genome assemblies and annotation data stored in the Genome Browser database. As a flexible
alternative to the graphical-based Genome Browser, this tool offers an enhanced level of query
support that includes restrictions based on field values, free-form SQL queries, and combined
queries on multiple tables. Output can be filtered to restrict the fields and lines returned, and
may be organized into one of several formats, including a simple tab-delimited file that can be
loaded into a spreadsheet or database as well as advanced formats that may be uploaded into the
Genome Browser as custom annotation tracks. The Table Browser provides a convenient alternative to
downloading and manipulating the entire genome and its massive data tracks. (See the
<a href="#Download">Downloading Genome Data</a> section.)</p>
<p>
For information on using the Table Browser features, refer to the
<a href="hgTablesHelp.html">Table Browser User Guide</a>.</p>
<a name="Sessions"></a>
<h2>Getting started using Sessions</h2>
<p>
The <a href="../../cgi-bin/hgSession" target="_blank">Sessions tool</a> allows users to configure
their browsers with specific track combinations, including custom tracks, and save the configuration
options. Multiple sessions may be saved for future reference, for comparison of scenarios or for
sharing with colleagues. Saved sessions <A href="hgSessionHelp.html#Lifespan">will not be expired</a>,
however we still recommend that you keep local back-ups of your session contents and any associated
custom tracks. <a href="/goldenPath/help/hgSessionHelp.html#CTs">User-generated tracks</a> can be saved
within sessions.</p>
<p>
This tool may be accessed by clicking the "My Data" pulldown in the top blue navigation
bar in any assembly and then selecting <strong>Sessions</strong>. To ensure privacy and security,
you must <a href="../../cgi-bin/hgSession" target="_blank">create an account</a> and/or
<a href="../../cgi-bin/hgSession" target="_blank">log in</a> to use the Session tool. Individual
sessions may be designated by the user as either "shared" or "non-shared" to
protect the privacy of confidential data. To avoid having a new shared session from someone else
override existing Genome Browser settings, users are encouraged to open a new web-browser instance
or to save existing settings in a session before loading a new shared session.</p>
<p>
For more detailed information on using the Session tool, see the
<a href="hgSessionHelp.html">Sessions User Guide</a>.</p>
<a name="GenomeGraphs"></a>
<h2>Getting started on Genome Graphs</h2>
<p>
The <a href="../../cgi-bin/hgGenome" target="_blank">Genome Graphs</a> tool can be used to display
genome-wide data sets such as the results of genome-wide SNP association studies, linkage studies,
and homozygosity mapping. This tool is not pre-loaded with any sample data; instead, you can upload
your own data for display by the tool.</p>
<p>
Once you have uploaded your data, you can view it in a variety of ways. You can view multiple sets
of genome-wide data simultaneously either as superimposed graphs or side-by-side graphs. Once you
see an area of interest in the Genome Graphs view, you can click on it to go directly to the Genome
Browser at that position. You can also set a significance threshold for your data and view only
regions or gene sets that meet that threshold.</p>
<p>
For information on using the Genome Graphs features, refer to the
<a href="hgGenomeHelp.html">Genome Graphs User Guide</a>.</p>
<a name="VisiGeneHelp"></a>
<h2>Using the VisiGene Image Browser</h2>
<p>
<a href="../../cgi-bin/hgVisiGene">VisiGene</a> is a browser for viewing <em>in situ</em> images. It
enables the user to examine cell-by-cell as well as tissue-by-tissue expression patterns. The
browser serves as a virtual microscope, allowing users to retrieve images that meet specific search
criteria, then interactively zoom and scroll across the collection.</p>
<p>
To start the VisiGene browser, click the VisiGene link in the left-hand sidebar menu on the
<a href="../../index.html">Genome Browser</a> home page.</p>
<h3>Images Available</h3>
<p>
The following image collections are currently available for browsing:</p>
<ul>
<li>
High-quality high-resolution images of eight-week-old male mouse sagittal brain slices with
reverse-complemented mRNA hybridization probes from the <a href="http://brain-map.org/"
target="_blank">Allen Brain Atlas</a>, courtesy of the <a href="http://www.alleninstitute.org/"
target="_blank">Allen Institute for Brain Science</a></li>
<li>
Mouse <em>in situ</em> images from the <a href="http://www.informatics.jax.org/expression.shtml"
target="_blank">Jackson Lab Gene Expression Database</a> (GXD) at MGI</li>
<li>
Transcription factors in mouse embryos from the Mahoney Center for Neuro-Oncology</li>
<li>
Mouse head and brain <em>in situ</em> images from NCBI's
<a href="https://www.ncbi.nlm.nih.gov/projects/gensat/" target="_blank">Gene Expression Nervous
System Atlas</a> (GENSAT) database</li>
<li>
<em>Xenopus laevis in situ</em> images from the <a href="http://www.nibb.ac.jp/en/"
target="_blank">National Institute for Basic Biology</a> (NIBB) XDB project</li>
</ul>
<h3>Searching the Image Database</h3>
<p>
The image database may be searched by gene symbols, authors, years of publication, body parts,
GenBank or UniProtKB accessions, organisms,
<a href="http://www.emouseatlas.org/emap/ema/theiler_stages/StageDefinition/stagedefinition.html"
target="_blank">Theiler stages</a> (mice), and <a href="http://www.xenbase.org/anatomy/alldev.do"
target="_blank">Nieuwkoop/Faber stages</a> (frogs). The search returns only those images that match
all the specified criteria. For a list of sample search strings, see the VisiGene Gateway page.</p>
<p>
The wildcard characters * and ? are supported for gene name searches. For example, to view the
images of all genes in the Hox A cluster, search for <em>hoxa*</em>. When searching on author names
that include initials, use the format <em>Smith AJ</em>.</p>
<h3>Image Navigation</h3>
<p>
Following a successful search, VisiGene displays a list of thumbnails of images matching the search
criteria in the lefthand pane of the browser. By default, the image corresponding to the first
thumbnail in the list is displayed in the main image pane. If more than 25 images meet the search
criteria, links at the bottom of the thumbnail pane allow the user to toggle among pages of search
results. To display a different image in the main browser pane, click the thumbnail of the image you
wish to view. </p>
<p>
By default, an image is displayed at a resolution that provides optimal viewing of the overall
image. This size varies among images. The image may be zoomed in or out, sized to match the
resolution of the original image or best fit the image display window, and moved or scrolled in any
direction to focus on areas of interest. The original full-sized image may also be downloaded.</p>
<p>
<strong>Zooming in:</strong> To enlarge the image by 2X, click the Zoom <em>in</em> button above
the image or click on the image using the left mouse button. Alternatively, the + key may be used
to zoom in when the main image pane is the active window.</p>
<p>
<strong>Zooming out:</strong> To reduce the image by 2X, click the Zoom <em>out</em> button above
the image or click on the image using the right mouse button. Alternatively, the - key may be used
to zoom out when the main image pane is the active window. </p>
<p>
<strong>Sizing to full resolution:</strong> Click the Zoom <em>full</em> button above the image to
resize the image such that each pixel on the screen corresponds to a pixel in the digitized
image.</p>
<p>
<strong>Sizing to best fit:</strong> Click the Zoom <em>fit</em> button above the image to zoom the
image to the size that best fits the main image pane.</p>
<p>
<strong>Moving the image:</strong> To move the image viewing area in any direction, click and drag
the image using the mouse. Alternatively, the following keyboard shortcuts may be used after
clicking on the image:
<ul>
<li>
<strong>Scroll left in the image:</strong> Left-arrow key or <em>Home</em> key</li>
<li>
<strong>Scroll right in the image:</strong> Right-arrow key or <em>End</em> key</li>
<li>
<strong>Scroll up in the image:</strong> Up-arrow key or <em>PgUp</em> key</li>
<li>
<strong>Scroll down in the image:</strong> Down-arrow key or <em>PgDn</em> key</li>
</ul>
<p>
<strong>Downloading the original full-sized image:</strong> Most images may be viewed in their
original full-sized format by clicking the "download" link at the bottom of the image
caption. NOTE: due to the large size of some images, this action may take a long time and could
potentially exceed the capabilities of some Internet browsers.</p>
<p>
If you have an image set you would like to contribute for display in the VisiGene Browser, contact
<a href="mailto:kent@soe.ucsc.edu">Jim Kent</a>.</p>
<a name="TrackFormatDNA"></a>
<h2>DNA text formatting</h2>
<p>
The Genome Browser provides a feature to configure the retrieval, formatting, and coloring of the
text used to depict the DNA sequence underlying the features in the displayed annotation tracks
window. Retrieval options allow the user to add a padding of extra bases to the upstream or
downstream end of the sequence. Formatting options range from simply displaying exons in upper case
to elaborately marking up a sequence according to multiple track data. The DNA sequence covered by
various tracks can be highlighted by case, underlining, bold or italic fonts, and color.</p>
<p>
The DNA display configuration feature can be useful to highlight features within a genomic sequence,
point out overlaps between two types of features (for example, known genes vs. gene predictions), or
mask out unwanted features.</p>
<h3>Using the DNA text formatting feature</h3>
<p>
To access the feature, click on the "View" pulldown on the top blue menu bar on the Genome
Browser page and select "DNA", or select the "Get DNA..." option from the Genome
Browser's <a href="#RIGHT_CLICK_NAV">right-click</a> menu depending on context. "The Get DNA in
Window" page that appears contains sections for configuring the retrieval and output
format.</p>
<p>
To display extra bases upstream of the 5' end of your sequence or downstream of the 3' end of the
sequence, enter the number of bases in the corresponding text box. This option is useful in looking
for regulatory regions.</p>
<p>
The Sequence Formatting section lists several options for adjusting the case of all or part of the
DNA sequence. To choose one of these formats, click the corresponding option button, then click the
<em>get DNA</em> button. To access a table of extended formatting options, click the <em>Extended
case/color options</em> button.</p>
<p>
The Extended DNA Case/Color page presents a table with many more format options. The page provides
instructions for using the formatting table, as well as examples of its use. The list of tracks in
the Track Name column is automatically generated from the list of tracks available on the current
genome.</p>
<h3>Tips for Use</h3>
<p>
A few caveats mentioned on the Extended DNA Case/Color page bear repeating. Keep the formatting
simple at first: it is easy to make a display that is pretty to look at but is also completely
cryptic. Also, be careful when requesting complex formatting for a large chromosomal region: when
all the HTML tags have been added to the output page, the file size may exceed the size limits that
your Internet browser, clipboard, and other software can safely display. The maximum size of genome
that can be formatted by the tool is approximately 10 Mbp.</p>
<a name="Convert"></a>
<h2>Converting data between assemblies</h2>
<p>
Coordinates of features frequently change from one assembly to the next as gaps are closed, strand
orientations are corrected, and duplications are reduced. Occasionally, a chunk of sequence may be
moved to an entirely different chromosome as the map is refined. There are three different methods
available for migrating data from one assembly to another: BLAT alignment, coordinate conversion,
and coordinate lifting. The BLAT alignment tool is described in the section
<a href="#BLATAlign">Using BLAT alignments</a>.</p>
<h3>Coordinate conversion</h3>
<p>
The Genome Browser Convert utility is useful for locating the position of a feature of interest in
a different release of the same genome or (in some cases) in a genome assembly of another species.
During the conversion process, portions of the genome in the coordinate range of the original
assembly are aligned to the new assembly while preserving their order and orientation. In general,
it is easier to achieve successful conversions with shorter sequences.</p>
<p>
When coordinate conversion is available for an assembly, click on the "View" pulldown on
the top blue menu bar on the Genome Browser page and select the "In Other Genomes
(Convert)" link. You will be presented with a list of the genome/assembly conversion options
available for the current assembly. Select the genome and assembly to which you'd like to convert
the coordinates, then click the <button>Submit</button> button. If the conversion is successful,
the browser will
return a list of regions in the new assembly, along with the percent of bases and span covered by
that region. Click on a region to display it in the browser. If the conversion is unsuccessful, the
utility returns a failure message.</p>
<a name="Liftover"></a>
<h3>Lifting coordinates</h3>
<p>
The liftOver tool is useful if you wish to convert a large number of coordinate ranges between
assemblies. This tool is available in both web-based and command line forms, and supports
forward/reverse conversions as well as conversions between species. You can use the
<a href="../../FAQ/FAQformat.html#format1">BED format</a> (e.g. "chr4 100000 100001",
0-based) or directly paste text from the position box ("chr4:100,001-100,001", 1-based).
-See our <a href="http://genome.ucsc.edu/blog/patches/">Coordinate Counting</a> blog post
+See our <a href="https://genome-blog.gi.ucsc.edu/blog/patches/">Coordinate Counting</a> blog post
for a discussion of the difference. If the coordinates do not cover a single base pair e.g.
"chr4 100000 100000" (BED) or "chr4:100,001-100,000" (text), this tool
automatically extends them to at least one base pair.</p>
<p>
<b>Note:</b> It is not recommeneded to use LiftOver to convert SNPs between assemblies,
and more information about how to convert SNPs between assemblies can be found on the following
<a href="/FAQ/FAQreleases.html#snpConversion">FAQ entry</a>.</p>
<h3>Web-based coordinate lifting</h3>
<p>
To access the graphical version of the liftOver tool, click on "Tools" pulldown in the
top blue menu bar of the Genome Browser, then select
<a href="http://genome.ucsc.edu/cgi-bin/hgLiftOver">LiftOver</a> from the menu.
Note that the web tool has an input file size limit of 500Mb, larger files will require
using the command-line version.</p>
<p>
To convert one or more coordinate ranges using the default conversion settings:</p>
<ol>
<li>
Select the genome and assembly from which the ranges were taken ("Original"), as well as
the genome and assembly to which the coordinates should be converted ("New").</li>
<li>
Select the Data Format option: Browser Extensible Data format
(<a href="../../FAQ/FAQformat.html#format1">BED</a>) or position (coordinates of the form
<em>chrN:start-end</em>).</li>
<li>
Enter coordinate ranges in the selected data format into the large text box, one per line.</li>
<li>
Click Submit.</li>
</ol>
<p>
Alternatively, you may load the coordinate ranges from an existing data file by entering the file
name in the upload box at the bottom of the screen, then clicking the Submit File button.</p>
<a name="liftParameters"></a>
<h3>LiftOver parameters</h3>
<p>
The default parameters for LiftOver are recommended for general use of the LiftOver tool. However,
you may want to customize settings if you have several very large regions to convert.</p>
<p>
Although the LiftOver program accepts position ranges as input, some settings are only available
when using a <a href="/FAQ/FAQformat.html#format1">BED line with standard columns</a>. The following
describes each setting and the input requirements to use each setting.
</p>
<ul>
<li>
<b>Position Coordinates or BED with 3 standard columns:</b>
<dl>
<dt>Minimum ratio of bases that must remap</dt>
<dd>
It may be beneficial to reduce this value when working with poor-quality assemblies or
cross-species conversions. For large-area conversions under these conditions, a value as low
as 0.01 may be used.
</dd>
<dd><i>[default: 0.95]</i></dd>
</dl>
</li>
<li>
<b>BED with 4 standard columns or greater:</b>
<dl>
<dt>Allow multiple output regions</dt>
<dd>
By default, liftOver does not return a match if the region is split in the new assembly. If
LiftOver can map a region more than once, and this setting isn't on, there will be no output
for the region. Consider checking this option for conversions involving high-quality data
within the same species. This option should not be used when mapping large regions, doing
cross-species conversions, or using fragmented poor-quality assemblies.
</dd>
<dd><i>[default: off]</i></dd>
<dt>Minimum chain size in target</dt>
<dd>
Only applicable when the "Allow multiple output regions" option is checked.
Increasing the minimum chain size in the target may reduce fragmentation. A low-complexity
or repetitive region may have lots of little matches across the genome that don't
necessarily imply the regions had a common ancestor or are orthologous. For example, when
doing large-scale conversions, we have found that a setting of 4,000 worked well for this
option.
</dd>
<dd><i>[default: 0]</i></dd>
<dt>Minimum hit size in query</dt>
<dd>
Only applicable when the "Allow multiple output regions" option is checked.
Consider using this filter to remove small targets below a certain length that may be
introduced by a repeat/transposon within a longer input region.
</dd>
<dd><i>[default: 0]</i></dd>
</dl>
</li>
<li>
<b>BED with 12 standard columns:</b>
<dl>
<dt>Min ratio of alignment blocks/exons that must map</dt>
<dd>
The minimum ratio of the number of exons (not their bases) covered by the alignment.
Transcripts lower than this will not be output at all. For example, with a value of 3, there
must be 3 exons from the transcript covered in the alignment to produce output. With a value
of 0.5, only half of an exon must be covered in the alignment.
</dd>
<dd><i>[default: 1]</i></dd>
<dt>If thickStart/thickEnd is not mapped, use the closest mapped base</dt>
<dd>
Recommended if adjusting the "minimum ratio of alignment blocks/exons that must
map". By default, if an exon (defined by thickStart to thickEnd in the BED) is not
alignable at all, it will be skipped in the alignment. If this option is checked, the exon
is lifted to the closest alignable base.
</dd>
<dd><i>[default: off]</i></dd>
</dl>
</li>
</ul>
<h3>Command-line coordinate lifting</h3>
<p>
The command-line version of liftOver offers the increased flexibility and performance gained by
running the tool on your local server. See an example of
<a href="../../FAQ/FAQdownloads.html#liftOver">running the liftOver tool</a> on the command line.
This utility requires access to a Linux platform. The
executable file may be downloaded <a href="https://genome-store.ucsc.edu">here</a>.
Command-line liftOver requires a UCSC-generated <em>over.chain</em> file as input. Pre-generated
files for a given assembly can be accessed from the assembly's "LiftOver files" link on
the <a href="http://hgdownload.soe.ucsc.edu/downloads.html">Downloads</a> page. If the desired
conversion file is not listed, send a request to the <a href="../../contacts.html">genome mailing
list</a> and we may be able to generate one for you. For use of the command-line
version of LiftOver, we require all for-profit businesses or commercial companies to
<a href="https://genome-store.ucsc.edu/">purchase a license</a> to support our small team.</p>
<a name="Download"></a>
<h2>Downloading genome data</h2>
<p>
Most of the underlying tables containing the genomic sequence and annotation data displayed in the
Genome Browser can be downloaded. All of the tables are freely usable for any purpose except as
indicated in the README.txt file in the download directories. This data was contributed by many
researchers, as listed on the Genome Browser <a href="../credits.html" target="_blank">Credits</a>
page. Please acknowledge the contributor(s) of the data you use.
<h3>Downloading the data</h3>
<p>
Genome data can be downloaded in different ways using our North American and European download
servers, hgdownload, hgdownload2, and hgdownload-euro.</p>
<dl>
<dt>Via rsync:</dt>
<dd>
The UCSC Genome Browser hgdownload server contains download directories for all genome versions
currently accessible in the Genome Browser. Either of the following rsync commands can quickly
and efficiently download large files to your current directory (./).</dd>
<pre><code>rsync -a -P rsync://hgdownload.soe.ucsc.edu/path/file ./</code></pre>
<pre><code>rsync -a -P rsync://hgdownload2.soe.ucsc.edu/path/file ./</code></pre>
<pre><code>rsync -a -P rsync://hgdownload-euro.soe.ucsc.edu/path/file ./</code></pre>
<dd>
To download an entire directory (note the trailing slash), you would use an expression such
as:</dd>
<pre><code>rsync -a -P rsync://hgdownload.soe.ucsc.edu/directory/ ./</code></pre>
<pre><code>rsync -a -P rsync://hgdownload2.soe.ucsc.edu/directory/ ./</code></pre>
<pre><code>rsync -a -P rsync://hgdownload-euro.soe.ucsc.edu/directory/ ./</code></pre>
<dd>
For more information please click <a href="../help/ftp.html" target="_blank">here</a>.</dd>
<dt>Via ftp:</dt>
<dd>
The UCSC Genome Browser FTP server contains download directories for all genome versions
currently accessible in the Genome Browser. The FTP URLs
<code>ftp://hgdownload.soe.ucsc.edu/goldenPath/</code>,
<code>ftp://hgdownload2.soe.ucsc.edu/goldenPath/</code>,
or
<code>ftp://hgdownload-euro.soe.ucsc.edu/goldenPath/</code>
will take you to a directory that contains the genome download directories. This download method
is not recommended if you plan to download a large file or multiple files from a single
directory compared to rsync (see above). You can, however, use the <code>mget</code> command to
download multiple files: <code>mget <em>filename1 filename2</em></code>, or <code>mget -a</code>
(to download all the files in the directory).</dd>
<dt>Via the Downloads link:</dt>
<dd>
Click the
<a href="http://hgdownload.soe.ucsc.edu/downloads.html" target="_blank">Downloads</a> link on
the left side bar on the UCSC Genome Browser home page to display a list of all database
directories available for download. If the data you wish to download pre-dates the assembly
versions listed, look for the data on our
<a href="http://hgdownload.soe.ucsc.edu/downloads.html" target="_blank">Downloads</a> page.</dd>
<dt>Via the REST API:</dt>
<dd>
The <a href='./api.html' target=_blank>REST API</a> can be used to query both annotation
and sequence data from any UCSC genome assembly or hub.</dd>
</dl>
<h3>Types of data available</h3>
<p>
There may be several download directories associated with each version of a genome assembly: the
full data set <em>(bigZips)</em>, the full data set by chromosome <em>(chromosome)</em>, the
annotation database tables <em>(database)</em>, and one or more sets of comparative cross-species
alignments.</p>
<p>
<em>BigZips</em> contains the entire draft of the genome in chromosome and/or contig form. Depending
on the genome, this directory may contain some or all of the following files:</p>
<ul>
<li>
<strong>chromAgp.zip:</strong> Description of how the assembly was generated, unpacking to one
file per chromosome.</li>
<li>
<strong>chromFa.zip:</strong> The assembly sequence chromosomes, in one file per chromosome.
Repeats from RepeatMasker and Tandem Repeats Finder are shown in lower case; non-repeating
sequence is in upper case. The main assembly is contained in the <em>chrN.fa</em> files, where
<em>chrN</em> is the name of the chromosome. The <em>chrN_random.fa</em> files contain clones
that are not yet finished or cannot be placed with certainty at a specific place on the
chromosome. In some cases, including the human HLA region on chromosome 6, the
<em>chrN_random.fa</em> files also contain haplotypes that differ from the main assembly.</li>
<li>
<strong>chromFaMasked.zip:</strong> The assembly sequence chromosomes, in one file per chromosome.
Repeats are masked by capital Ns; non-repeating sequence is shown in upper case.</li>
<li>
<strong>chromOut.zip:</strong> RepeatMasker <em>.out</em> file for chromosomes, generated by
RepeatMasker at the <em>-s</em> sensitive setting.</li>
<li>
<strong>chromTrf.zip:</strong> Tandem Repeats Finder locations, filtered to keep repeats with
period less than or equal to 12, translated into one <em>.bed</em> file per chromosome.</li>
<li>
<strong>contigAgp.zip:</strong> Description of how the assembly was generated from fragments at a
contig layout level.</li>
<li>
<strong>contigFa.zip:</strong> The assembly sequence contigs, in one file per contig. All contigs
are in forward orientation relative to the chromosome. In some cases, this means that contigs will
be reversed relative to their orientation in the NCBI assembly. Repeats are shown in lower case;
non-repeating sequence is shown in upper case.</li>
<li>
<strong>contigFaMasked.zip:</strong> The assembly sequence contigs, in one file per contig.
Repeats are masked by capital <em>N</em>s; non-repeating sequence is shown in upper case.</li>
<li>
<strong>contigOut.zip:</strong> RepeatMasker <em>.out</em> file for contigs, generated by
RepeatMasker at the <em>-s</em> sensitive setting.</li>
<li>
<strong>contigTrf.zip:</strong> Tandem Repeats Finder locations, filtered to keep repeats with
period less than or equal to 12, and translated into one <em>.bed</em> file per contig.</li>
<li>
<strong>database.zip:</strong> The Genome Browser database as tab-delimited files and associated
MariaDB (MySQL) table-creation tiles (eliminated in later assemblies due to size restrictions).</li>
<li>
<strong>est.fa.zip:</strong> Sequences of all GenBank ESTs for the selected species.</li>
<li>
<strong>liftAll.zip:</strong> The offsets of contigs within chromosomes.</li>
<li>
<strong>mrna.zip:</strong> mRNAs in GenBank from the selected species.</li>
<li>
<strong>refmrna.zip:</strong> RefSeq mRNAs from the selected species.</li>
<li>
<strong>upstream1000.zip:</strong> Sequences 1000 bases upstream of annotated transcription start
of RefSeq genes. This includes only cases where the transcription start is annotated separately
from the coding region start.</li>
<li>
<strong>upstream2000.zip:</strong> Same as upstream1000, but with 2000 bases.</li>
<li>
<strong>upstream5000.zip:</strong> Same as upstream1000, but with 5000 bases.</li>
<li>
<strong>xenoMrna.zip:</strong> All GenBank mRNAs from species other than that of the selected
one.</li>
</ul>
<p>
<em>Chromosomes</em> contains the assembled sequence for the genome in separate files for each
chromosome in a zipped fasta format. The main assembly can be found in the <em>chrN.fa</em> files,
where <em>N</em> is the name of the chromosome. The <em>chrN_random.fa</em> files contain clones
that are not yet finished or cannot be placed with certainty at a specific place on the chromosome.
In some cases, the <em>chrN_random.fa</em> files also contain haplotypes that differ from the main
assembly.</p>
<p>
<em>Database</em> contains all of the positional and non-positional tables in the genome annotation
database. Each table is represented by 2 files:</p>
<ul>
<li><strong>.sql file:</strong> the SQL commands used to create the table.</li>
<li>
<strong>.txt.gz file:</strong> the MariaDB database table data in tab-delimited format and
compressed with gzip.</li>
</ul>
<p>
Schema descriptions for all tables in the genome annotation database may be viewed by using the
"data format description" button in the <a href="#TableBrowser">Table Browser</a>.</p>
<p>
<em>Cross-species alignments</em> directories, such as the <em>vsMm4</em> and <em>humorMm3Rn3</em>
directories in the hg16 assembly, contain pairwise and multiple species alignments and filtered
alignment files used to produce cross-species annotations. For more information, refer to the
READMEs in these directories and the description of the
<a href "../../FAQformat.html#format5">Multiple Alignment Format</a> (MAF).</p>
<!-- =======Custom tracks======= -->
<a name="CustomTracks"></a>
<h2>Creating custom annotation tracks</h2>
<!--#include virtual="customTrackText.html"-->
<a name="TrackHubs"></a>
<h2>Getting started on Track Hubs</h2>
<p>
Track hubs are web-accessible directories of genomic data that can be viewed on the UCSC Genome
Browser alongside native annotation tracks. Hubs are a useful tool for visualizing a large number
of genome-wide data sets. The <a href="../../cgi-bin/hgHubConnect" target="_blank">Track Hub</a>
utility allows efficient access to data sets from around the world through the familiar Genome
Browser interface. Browser users can display tracks from any public track hub that has been
registered with UCSC. We offer <a href="publicHubGuidelines.html" target="_blank"> guidelines</a>
for those who want to make a hub a public track hub. Additionally, users can import data from
unlisted hubs or can set up, display, and share their own track hubs.</p>
<p>
For information on using the Track Hub features, refer to the <a href="hgTrackHubHelp.html">Genome
Browser Track Hub User Guide</a>. For specific information on configuring your trackDb.txt file,
refer to the <a href="trackDb/trackDbHub.html">Track Database Definition Document</a>. See also the
<a href="hubQuickStart.html" target="_blank">Basic Hub Quick Start Guide</a>,
<a href="hubQuickStartGroups.html" target="_blank">Quick Start Guide to Organizing Track Hubs into
Groupings</a>, <a href="https://genome-blog.soe.ucsc.edu/blog/2022/06/28/track-hub-settings/"
target="_blank">Track hub settings blog post</a>, <a href="hubQuickStartAssembly.html"
target="_blank">Quick Start Guide to Assembly Hubs</a>, <a href="hubQuickStartSearch.html"
target="_blank">Quick Start Guide to Searchable Track Hubs</a>, and <a href="/FAQ/FAQlink#hubUrl"
target="_blank">Loading Track Hubs and Assembly Hubs with the URL</a>.</p>
<a name="GenArkTrackHubs"></a>
<h2>Track Hubs for <em>GenArk</em> assembly hub</h2>
<p>
To construct a track hub that will display on a
<a href='https://hgdownload.soe.ucsc.edu/hubs/'
target=_blank>GenArk Assembly</a> hub, specify the <em>GenArk</em> assembly
name in the <b>genome</b> statement in your <b>hub.txt</b> file as
<a href='#UseOneFile'>described below</a>.
For example, a reference such as:
</p>
<pre>
genome GCA_021951015.1
</pre>
<p>
will direct your track hub to display on the human
<b>Feb. 2022 - GCA_021951015.1 - HG002.mat.cur.20211005</b> genome assembly.
</p>
<p>
To share your track hub with your audience of interest, when you publish
the URL to your track hub, that <b>genome</b> reference in your track
<b>hub.txt</b> file will cause that associated assembly hub to display in the
genome browser with your track hub annotations on that genome browser. There
is no need to otherwise reference the assembly hub, it will automatically
attach
itself.
</p>
<p>
A complete list of all available <em>GenArk</em> assemblies available can
be seen in the text file
<a href='https://hgdownload.soe.ucsc.edu/hubs/UCSC_GI.assemblyHubList.txt'
target=_blank>UCSC_GI.assemblyHubList.txt</a>.
</p>
<a name="UseOneFile"></a>
<h2>Track Hubs in a single file</h2>
<p>
Historically, a hub needed a set of text files to specify properties for a track hub and each of
the data tracks within the hub. The track hub settings were stored in a three file structure:
hub.txt, genomes.txt, and trackDb.txt</p>
<pre>
myHub/ - directory containing track hub files
* hub.txt - a short description of hub properties
* genomes.txt - list of genome assemblies included in the hub data
* hg19/ - directory of data for the hg19 (GRCh37) human assembly
** trackDb.txt - display properties for tracks in this directory
</pre>
<p>
Now, there is a trackDb option to have your entire track hub inside of one file,
<code>useOneFile on</code>. Adding the <code>useOneFile on</code> line to the hub.txt section of the
file allows the contents of all three files to be referenced inside of one file. We recommend the
single hub.txt file's contents be in the following order: hub.txt, genomes.txt, then trackDb.txt.
</p>
<pre>
hub myExampleHub
shortLabel Example Hub
longLabel Example Hub for useOneFile option
useOneFile on
email genome-www@soe.ucsc.edu
genome hg19
track vcfExample
shortLabel VCF example
longLabel VCF: 1000 Genomes phase 1 interim SNVs
visibility pack
type vcfTabix
maxWindowToDraw 200000
bigDataUrl http://genome.ucsc.edu/goldenPath/help/examples/vcfExample.vcf.gz
track bamExample
shortLabel BAM example
longLabel Bam: 1000 Genomes read alignments (individual NA12878)
visibility squish
type bam
pairSearchRange 10000
bamColorMode grey
maxWindowToDraw 200000
bigDataUrl http://genome.ucsc.edu/goldenPath/help/examples/bamExample.bam
</pre>
<p>
The hub above can be accessed using the following URL to the single file,
<a href="./examples/hubExamples/hubUseOneFile/singleFileHubExample.txt"
target="_blank">singleFileHubExample.txt</a>.</p>
<h3>Limitations</h3>
<p>
Unfortunately, the <code>useOneFile on</code> setting limits the hub to one assembly. The
<code>useOneFile on</code> setting works by having the genomes.txt file point to only one
trackDb.txt file, which is the file itself. Although this method limits you to one genome assembly,
using the setting grants the advantage of not embedding file names in the hub architecture. So a
simple name change to a hub file will no longer require editing the contents inside the hub.txt and
genomes.txt files.</p>
<h3>Converting an existing Track Hub to one file</h3>
<p>
Converting an existing track hub to use the new setting does not require much editing. Simply
concatenate the three files into one, with the contents of hub.txt, genomes.txt, and trackDb.txt, in
that order. Using the URL to the single file on the
<a href="../../cgi-bin/hgHubConnect?#unlistedHubs">Connected Hubs</a> page will allow you to view your
track hub.</p>
<!--#include virtual="$ROOT/inc/gbPageEnd.html" -->