9cfa269e30bc186cd46a58e6d53f9faa61d3fb88
gperez2
  Thu Jun 20 14:20:02 2024 -0700
Switching Track search page, Get DNA page, hgBlat, hgSession, hgPcr, and hgCustom buttons to sentence case, refs #25787

diff --git src/hg/hgBlat/hgBlat.c src/hg/hgBlat/hgBlat.c
index 634be73..5e4d2fa 100644
--- src/hg/hgBlat/hgBlat.c
+++ src/hg/hgBlat/hgBlat.c
@@ -1885,31 +1885,31 @@
 
 printf("<TR>\n"); 
 puts("<TD COLSPAN=5 WIDTH=\"100%\">\n" 
     "Paste in a query sequence to find its location in the\n"
     "the genome. Multiple sequences may be searched \n"
     "if separated by lines starting with '>' followed by the sequence name.\n"
     "</TD>\n"
     "</TR>\n"
 );
 
 puts("<TR><TD COLSPAN=5 WIDTH=\"100%\">\n"); 
 puts("<BR><B>File Upload:</B> ");
 puts("Rather than pasting a sequence, you can choose to upload a text file containing "
 	 "the sequence.<BR>");
 puts("Upload sequence: <INPUT TYPE=FILE NAME=\"seqFile\">");
-puts(" <INPUT TYPE=SUBMIT Name=Submit VALUE=\"submit file\"><P>\n");
+puts(" <INPUT TYPE=SUBMIT Name=Submit VALUE=\"Submit file\"><P>\n");
 printf("%s", 
 "<P>Only DNA sequences of 25,000 or fewer bases and protein or translated \n"
 "sequence of 10000 or fewer letters will be processed.  Up to 25 sequences\n"
 "can be submitted at the same time. The total limit for multiple sequence\n"
 "submissions is 50,000 bases or 25,000 letters.<br> A valid example "
 "is <tt>GTCCTCGGAACCAGGACCTCGGCGTGGCCTAGCG</tt> (human SOD1).\n</P>\n");
 
 printf("%s", 
 "<P>The <b>Search all</b> checkbox allows you to search all genomes at the same time. "
 "Search all is only available for default assemblies and attached hubs with dedicated BLAT servers."
 "The new dynamic BLAT servers are not supported, and they are noted as skipped in the output. "
 "<b>See our <a href='/FAQ/FAQblat.html#blat9'>BLAT All FAQ</a> for more information.</b>\n"
 );
 
 printf("<P>The <b>All Results</b> checkbox disables minimum matches filtering so all results are seen."