042a715e5951d7455ce4e51bb96ebe9a03160bea
jnavarr5
  Fri Jun 21 15:54:18 2024 -0700
Adding the new tutorial to the makefile. Moving both tutorials to a new 'tutorials' subdirectory, refs #33732

diff --git src/hg/js/tutorial.js src/hg/js/tutorial.js
deleted file mode 100644
index b85c88d..0000000
--- src/hg/js/tutorial.js
+++ /dev/null
@@ -1,258 +0,0 @@
-function displaySelectedOption(selectId) {
-  const selectElement = document.getElementById(selectId);
-  const selectedOption = selectElement.options[selectElement.selectedIndex].text;
-  return selectedOption;
-}
-
-
-const tour = new Shepherd.Tour({
-  defaultStepOptions: {
-    cancelIcon: {
-      enabled: true
-    },
-    classes: 'class-1 class-2',
-    scrollTo: { behavior: 'smooth', block: 'center' }
-  },
-  useModalOverlay: true
-});
-
-// log when a tutorial is started
-tour.on('start', function() {
-    writeToApacheLog("tutorial start " + getHgsid());
-});
-
-var tutorialButtons = {
-    'back': {
-        action() {
-            return this.back();
-        },
-        classes: 'shepherd-button-secondary',
-        text: 'Back'
-    },
-    'next': {
-        action() {
-            return this.next();
-        },
-        text: 'Next'
-    },
-    'end': {
-        action() {
-            // log when the tutorial is finished
-            writeToApacheLog("tutorial finish " + getHgsid());
-            localStorage.setItem("hgTracks_hideTutorial", "1");
-            return this.complete();
-        },
-        classes: 'shepherd-button-secondary',
-        text: 'Finish'
-    }
-};
-
-// wrap setup in a function to be called only after  document is ready
-function setupSteps()
-{
-    selectMiddleButton = (function () {
-        var hgTracksTable = document.getElementById('imgTbl');
-        var rowCount = hgTracksTable.rows.length;
-        var middleIndex = Math.floor(rowCount / 2);
-        var middleRow = hgTracksTable.rows[middleIndex];
-        var firstId = middleRow.querySelector('td');
-        var middleTrackId = firstId.id;
-        return '#' + middleTrackId;
-    })();
-
-    tour.addStep({
-        title: 'Welcome to the UCSC Genome Browser Tutorial',
-        text: 'The navigation bar at the top of the page will allow you to access the ' +
-              'tools, downloads, and help pages. There are four main drop-downs that are useful ' +
-              'for most users: ' +
-              '<ul>' +
-              '<li><b>Genomes</b> - switch between the many genomes available</li> ' +
-              '<li><b>Genome Browser</b> - configure, search for tracks, and reset the ' +
-               'Genome Browser back to the default settings.</li>' +
-              '<li><b>Tools</b> - access to features such as <a target="_blank" ' +
-               'href="/cgi-bin/hgBlat">BLAT</a>, <a target="_blank" href="/cgi-bin/hgPcr">isPCR</a>, '+
-               'and <a target="_blank" href="/cgi-bin/hgLiftOver">LiftOver</a>. The <a target="_blank" '+
-               'href="/cgi-bin/hgTables">Table Browser</a> can also be used to export track data in ' +
-               'various file formats.</li>' +
-              '<li><b>My Data</b> - create stable short links (<a target="_blank" '+
-               'href="/cgi-bin/hgSession">Sessions</a>), and visualize '+
-               'your own data via <a target="_blank" href="/cgi-bin/hgCustom">custom tracks</a> or ' +
-               '<a target="_blank" href="/cgi-bin/hgHubConnect">track hubs</a>.</li>'+
-              '<li><b>Help</b> - access contact information, FAQs, and Browser Documentation.</li>' +
-              '</ul>',
-        attachTo: {
-            element: '#nice-menu-1',
-            on: 'bottom'
-        },
-        buttons: [tutorialButtons['next'], tutorialButtons['end']],
-        id: 'navbar',
-        classes: 'dark-background'
-    });
-
-
-    tour.addStep({
-        title: 'Browsing the Genome',
-        text: 'The search bar allows you to navigate to a region on the genome using ' +
-              '<a href="https://genome-blog.soe.ucsc.edu/blog/2016/12/12/the-ucsc-genome-browser-coordinate-counting-systems/"' +
-              'target="_blank">genome coordinates</a>, <a href="/FAQ/FAQgenes.html#genename" ' +
-              'target="_blank">gene symbols</a>, <a href="https://www.ncbi.nlm.nih.gov/snp/docs/RefSNP_about/#what-is-a-reference-snp" ' +
-              'target="_blank">rsIDs</a>, <a href="http://varnomen.hgvs.org/" ' +
-              'target="_blank">HGVS</a> terms, or DNA sequence. You can even search documentation' +
-              'and FAQ pages using this search bar. A few example queries are: ' +
-              '<ul>' +
-              '<li>chr1:127140001-127140001</li>' +
-              '<li>SOD1</li>' +
-              '<li>rs2569190</li>' +
-              '<li>NM_198056.3:c.1654G>T</li>' +
-              '<li>CCTTCCTATAGTCCGGAATACGCC<br>' +
-              'AATGGCGCGGCCGGCCTGGACC<br>' +
-              'ACTCCCATTACGGGGGTGTCCC<br>' +
-              'GGGCAGCGGGGCCGGAGGCTTA<br>' +
-              'ATGCAAAGGC</li></ul>' +
-              'Please note, <a href="/goldenPath/help/hgTracksHelp.html#BLATAlign" target="_blank">BLAT</a> '+
-              'is used if your search term is a DNA sequence. For the best ' +
-              'results, make sure your sequence is long enough to meet BLAT specifications. The ' +
-              '<a href="/goldenPath/help/query.html" target="_blank">examples</a> link next to ' +
-              'the search bar contains even more search queries.' ,
-        attachTo: {
-            element: '#positionInput',
-            on: 'bottom'
-        },
-        buttons: [tutorialButtons['back'], tutorialButtons['next']],
-        id: 'search'
-    });
-
-    tour.addStep({
-        title: 'Drag-and-Select the Genome Browser Image',
-        text: 'Dragging the Genome Browser image performs different tasks depeneding on where and ' +
-              'how you click the image. <br><br> '+
-              'Click-and-Drag the ruler at the top of the image will bring up a menu to zoom into '+
-              'or highlight the region. Click-and-Drag anywhere else on the Genome Browser image '+
-              'will allow you to scroll to the left or right.' +
-              '<br><br>' +
-              'Alternatively, you can: '+
-              '<ul>'+
-              '<li>Hold <b>Alt+drag</b> or <b>Option+drag</b> to highlight</li>'+
-              '<li>Hold <b>Ctrl+drag</b> or <b>Cmd+drag</b> to zoom</li>'+
-              '</ul>',
-        attachTo: {
-            element: '#td_data_ruler',
-            on: 'bottom',
-        },
-        buttons: [tutorialButtons['back'], tutorialButtons['next']],
-        id: 'highlight'
-    });
-
-    tour.addStep({
-        title: 'Quick Link to Change Track Settings',
-        text: 'Clicking on the rectangle box next to a track is an easy way to quickly ' +
-              'go to the track settings page for that track.' +
-              '<br><br>' +
-              '<a href="/goldenPath/help/hgTracksHelp.html#RIGHT_CLICK_NAV" ' +
-              'target="_blank">Right-clicking</a> on the track will also bring up a menu ' +
-              'to change the display mode, configure a track, or view a PNG image of the current ' +
-              'window.' +
-              '<img src="/images/right_click_example.png" width="350">' +
-              '',
-        attachTo: {
-            element: selectMiddleButton,
-            on: 'right',
-        },
-        buttons: [tutorialButtons['back'], tutorialButtons['next']],
-        id: 'hgTrackUiLink'
-    });
-
-    tour.addStep({
-        title: 'Changing the Display Mode of a Track',
-        text: 'Annotation tracks can be entirely hidden or shown in four different ways that take ' +
-              'an increasing amount of vertical space: ' +
-              '<a href="/goldenPath/help/hgTracksHelp.html#TRACK_CONT" target="_blank">dense, squish, '+
-              'pack, and full</a>.'+
-              '<br><br>' +
-              'After changing the display mode of a track, the change will not be applied ' +
-              'until after you refresh the page. You could either refresh the page manually ' +
-              'using your web browser or you can click <button>refresh</button> on any of the ' +
-              'track groups.',
-        attachTo: {
-            element: function() {return $("input[name='hgt\.refresh']").slice(0)[0];},
-            on: 'bottom'
-        },
-        buttons: [tutorialButtons['back'], tutorialButtons['next']],
-        id: 'refresh'
-    });
-
-    tour.addStep({
-        title: 'Searching for Tracks on the Genome Browser',
-        text: 'Having trouble finding a dataset for your genome assembly? The ' +
-            '<a href="/cgi-bin/hgTracks?hgt_tSearch=track+search" target="_blank">Track Search</a> ' +
-            'feature allows searching for terms in track names, descriptions, groups, and ENCODE ' +
-            'metadata. <br><br>'+
-            'More information about <button>track search</button> can be found on the following ' +
-            '<a href="/goldenPath/help/trackSearch.html" target="_blank">help page</a>. '+
-            'The Track Search feature can also be accessed by hovering over the ' +
-            '"Genome Browser" drop-down menu.',
-        attachTo: {
-            element: '#hgt_tSearch',
-            on: 'top'
-        },
-        buttons: [tutorialButtons['back'], tutorialButtons['next']],
-        id: 'shortCuts',
-    });
-
-    tour.addStep({
-        title: 'Configure the Genome Browser Image',
-        text: 'Use the <button>configure</button> button to customize graphic font, size, gridlines, ' +
-              'and more. This can be helpful when exporting an image for publication. ' +
-              '<br><br>' +
-              'You can also find a link to configure the browser image by hovering over the ' +
-              '"Genome Browser" drop-down menu.',
-        attachTo: {
-            element: '#hgTracksConfigPage',
-            on: 'bottom'
-        },
-        buttons: [tutorialButtons['back'], tutorialButtons['next']],
-        id: 'configure'
-    });
-
-    tour.addStep({
-    title: 'Flip the Strand Orientation',
-    text: 'By default, the UCSC Genome Browser displays the forward strand (5\' to 3\'), but ' +
-          'it can be configured to display the negative strand (3\' to 5\'). <br><br>' +
-          'To reverse the genome orientation, click the <button>reverse</button> button and the Genome Browser image '+
-          'will flip to show either the negative or positive strand.',
-        attachTo: {
-            element: document.getElementById('hgt.toggleRevCmplDisp'),
-            on: 'bottom'
-        },
-        buttons: [tutorialButtons['back'], tutorialButtons['next']],
-        id: 'reverse'
-    });
-
-    tour.addStep({
-        title: 'Further Training and Contact Information',
-        text: 'You can find other guides and training videos on the ' +
-              '<a href="../training/" target="_blank">training page</a>. ' +
-              'You can also search the ' +
-              '<a href="https://groups.google.com/a/soe.ucsc.edu/g/genome" target="_blank">mailing list archive</a> ' +
-              'to find previously answered questions for guidance. ' +
-              '<br><br>' +
-              'If you still have questions after searching the ' +
-              '<a href="/FAQ/" target="_blank">FAQ page</a> or ' +
-              '<a href="/goldenPath/help/hgTracksHelp.html" target="_blank">Genome Browser User Guide</a> ' +
-              'pages, you can email the suitable mailing list for your inquiry from the ' +
-              '<a href="../contacts.html">contact us</a> page. ' +
-              '<br><br>' +
-              'Follow these <a href="/cite.html" target="_blank">citation guidelines</a> when using ' +
-              'the Genome Browser tool suite or data from the UCSC Genome Browser database in a ' +
-              'research work that will be published in a journal or on the Internet. <br><br>' +
-              'In addition to the <a href="/goldenPath/pubs.html" target="_blank">relevant paper</a>, '+
-              'please include a reference to the Genome Browser website in your manuscript: '+
-              '<i>http://genome.ucsc.edu</i>. ',
-        attachTo: {
-            element: '#help.menuparent',
-            on: 'bottom'
-        },
-        buttons: [tutorialButtons['back'], tutorialButtons['end']],
-        id: 'lastPopUp'
-    });
-}