9d466707e0a2fff3df7453c54b5131c46ad8cc61
mspeir
  Fri Nov 8 20:56:23 2024 -0800
Adding initial pass of tutorial text, refs #30335

diff --git docs/gb101.md docs/gb101.md
index 7984535..bb3e36e 100644
--- docs/gb101.md
+++ docs/gb101.md
@@ -1,171 +1,313 @@
 % Genome Browser Tutorials
 
 # Introduction to the UCSC Genome Browser
 
 This page attempts to introduce you to the basics of using the UCSC Genome Browser including:
 
 - Basic Navigation
 - Basic Table Browser Query
 - Basic BLAT Query
 
 ## Sections
 
 Use the sections below to learn about the UCSC Genome Browser interface.
 
 <div class="row" style="padding-top: 15px">
 <div class="col-md-4">
 <div class="panel panel-default" style="padding-bottom: 10px">
 <h3 class="panel-title" style="width: -webkit-fill-available;"
 >Genome Browser Interface</h3>
 
-Annotated screenshot of the Genome Browser interface. Explains what all the buttons do
+Annotated screenshot of the Genome Browser interface.
 
 <p style="text-align: end">
 <button>[View](#annot-screenshot)</button>
 </p>
 </div>
 </div>
+
 <div class="col-md-4">
 <div class="panel panel-default" style="padding-bottom: 10px">
 <h3 class="panel-title" style="width: -webkit-fill-available;"
 >Guided Workthrough</h3>
 
-Explains the basis of using/navigating the Genome Browser interface. 
-Also explains a very basic Table Browser query and BLAT query.
+Explains the basics of using/navigating the Genome Browser interface. 
 
 <p style="text-align: end">
 <button>[View](#guided-work)</button>
 </p>
 </div>
 </div>
-<div class="col-md-4" style="padding-top: 15px">
+
+<div class="col-md-4">
 <div class="panel panel-default" style="padding-bottom: 10px">
 <h3 class="panel-title" style="width: -webkit-fill-available;"
 >Interactive Tutorial</h4>
 
 Steps you through the basic functionality in the Genome Browser itself.  
 
 
 <p style="text-align: end">
 <button>[View](../cgi-bin/hgTracks?#showTutorial)</button>
 </p>
 </div>
 </div>
 </div>
 
 ## Annotated Screenshot
 
 ```image
 src=../images/annot-screenshot-sarCov2.jpg
 width=30%
 ```
 
 ![Annotated image of the UCSC Genome Browser Interface](../images/annot-screenshot-sarCov2.jpg)
 
 | Item | Explanation |
 |------|-------------|
 | Menu | Find BLAH   |
 
 (We need something below the table otherwise later markdown isnt properly interpreted)
 
 ## Guided Workthorugh
 
-This walkthrough will take you through the basic Genome Browser functionality.
-
-By the end of the workthrough you should be able to do these three things:
-
-1. Naviagte the Genome Browser Interface
-2. Perform a basic Table Browser query
-3. Perform a simple BLAT query
-
-### Genome Browser Basics
-
-In this guided walkthrough, we go from selecting our genome (hg38 in this
-case), to going to our gene of interest (BLAH), to turning off and on some of
-our favorite tracks, before finally BLAH. 
+This walkthrough will take you through the basic Genome Browser functionality teaching you how to
+turn on and off tracks, BLAH, and BLAH.
 
-#### Step 1: Choose your genome
+### Navigating the Menus
 
 <!--
 We are going to use bootstrap columns to put the image/text side by side
 Alternate the images left/right between different sections, mostly for aesthetics
 --->
 
 <div class="row">
 <div class="col-md-6">
 
 <img src="../images/GenomeSelect.jpg" alt="Genome selection" style="max-width:100%;">
 
 </div>
 <div class="col-md-6">
 
-Go to BLAH, select your genome from the diagram or search for in the search box at the top left of the screen.
+The navigation bar at the top of the page will allow you to access our tools, downloads, and help pages.
+
+There are five main drop-downs that are useful for most users:
+
+- Genomes - switch between the many genomes available.
+- Genome Browser - configure, search for tracks, and reset the Genome Browser back to the default settings.
+- Tools - access to features such as [BLAT](../cgi-bin/hgBlat), [isPCR](../cgi-bin/hgPcr), and [LiftOver](../cgi-bin/hgLiftOver). The [Table Browser](../cgi-bin/hgTables) can also export track data in various file formats.
+- My Data - create stable short links ([Sessions](../cgi-bin/hgSession)) and visualize your own data via [custom tracks](../cgi-bin/hgCustom) or [track hubs](../cgi-bin/hgHubConnect).
+- Help - access contact information, FAQs, and Browser Documentation.
 
-For this walkthrough, we will select "Human" and stick with the default GRCh38/hg38 assembly.
 </div>
 </div>
 
-<!-- note to self, something seems off with the image handling here? like too wide and not auto-fitting to the col -->
-
-#### Step 2: Navigate to your gene of interest
+### Using the Search Box
 
 <div class="row">
 <div class="col-md-6">
 
-After selecting a genome, enter a gene name into the search box. In our case,
-we will enter "HUNK", a gene for BLAH, into the search box. 
+The search bar allows you to navigate to a region on the genome using [genome coordinates](https://genome-blog.soe.ucsc.edu/blog/2016/12/12/the-ucsc-genome-browser-coordinate-counting-systems/),
+[gene symbols](https://genome.ucsc.edu/FAQ/FAQgenes.html#genename),
+[rsIDs](https://www.ncbi.nlm.nih.gov/snp/docs/RefSNP_about/#what-is-a-reference-snp),
+[HGVS](http://varnomen.hgvs.org/) terms, or DNA sequence. You can even
+search documentation and FAQ pages using this search bar. A few example queries
+are:
+
+- chr1:127140001-127140001
+- SOD1
+- rs2569190
+- NM_198056.3:c.1654G>T
+- CCTTCCTATAGTCCGGAATACGCC
+AATGGCGCGGCCGGCCTGGACC
+ACTCCCATTACGGGGGTGTCCC
+GGGCAGCGGGGCCGGAGGCTTA
+ATGCAAAGGC
+
+
+
+Please note, [BLAT](https://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html#BLATAlign)
+is used if your search term is a DNA sequence. For the best
+results, make sure your sequence is long enough to meet BLAT specifications.
+The [examples](https://genome.ucsc.edu/goldenPath/help/query.html)
+link next to the search bar contains even more search queries.
 
-After typing in the name, select the gene name "HUNK" from the list that
-appears below the search box. You will be taken directly to that gene location. 
 </div>
 <div class="col-md-6">
 
 <img src="../images/GeneSearch.jpg" alt="Genome selection" style="max-width:100%;">
 
 </div>
 </div>
 
-#### Step 3: Configure the Genome Browser tracks
+### Highlights and Zooming
+
+<div class="row">
+<div class="col-md-6">
+
+<!--
+<img> here
+-->
+
+</div>
+<div class="col-md-6">
+
+Dragging the Genome Browser image performs different tasks depending on where and how you click the image.
+
+Click-and-Drag the ruler at the top of the image will bring up a menu to zoom
+into or highlight the region. Click-and-Drag anywhere else on the Genome
+Browser image to scroll to the left or right.
+
+Alternatively, you can:
+
+- Hold **Alt+drag** or **Option+drag** to highlight
+- Hold **Ctrl+drag** or **Cmd+drag** to zoom
+
+</div>
+</div>
+
+
+### Configuring Data Track Display
 
 <div class="row">
 <div class="col-md-6">
 
-The horizontal lines of genomic data in the UCSC Genome Browser are known as **tracks**. they may BLAH, BLAH, and BLAH
+Clicking on the rectangle box next to a track is an easy way to go to that
+track's settings page quickly.
+
+[Right-clicking](../goldenPath/help/hgTracksHelp.html#RIGHT_CLICK_NAV)
+on the track will also bring up a menu to change the display
+mode, configure a track, or view a PNG image of the current window.
 
 </div>
 <div class="col-md-6">
 
 <!--
 <img> here
 -->
 
 </div>
 </div>
 
-### Simple Table Browser Query
+### Track Display Modes
+
+<div class="row">
+<div class="col-md-6">
 
-#### Step 1:
+<!--
+<img> here
+-->
 
-BLAH
+</div>
+<div class="col-md-6">
 
-#### Step 2:
+Annotation tracks can be entirely hidden or shown in four different ways that
+take an increasing amount of vertical space: 
+[dense, squish, pack, and full](../goldenPath/help/hgTracksHelp.html#TRACK_CONT).
 
-BLAH
+*Pack display is the recommended visibility for most data types as it provides
+the best balance of information and space.*
 
-#### Step 3:
+After changing a track's display mode, the change will not be applied until you
+refresh the page. You can either refresh the page manually using your web
+browser or click <button>refresh</button> on any of the track groups.
 
-BLAH
+</div>
+</div>
 
-### Simple BLAT Query
+### Searching for Data Tracks
 
-#### Step 1:
+<div class="row">
+<div class="col-md-6">
 
-BLAH
+Having trouble finding a dataset for your genome assembly? The 
+[Track Search](../cgi-bin/hgTracks?hgt_tSearch=track+search)
+feature allows searching for terms in track names, descriptions, groups, and
+ENCODE metadata.
 
-#### Step 2:
+More information about <button>track search</button> can be found on the following
+[help page](../goldenPath/help/trackSearch.html). The Track Search feature can
+also be accessed by hovering over the "Genome Browser" drop-down menu.
 
-BLAH
+</div>
+<div class="col-md-6">
 
-#### Step 3:
+<!--
+<img> here
+-->
 
-BLAH
+</div>
+</div>
+
+### Configuring the Genome Browser Display
+
+<div class="row">
+<div class="col-md-6">
+
+<!--
+<img> here
+-->
+
+</div>
+<div class="col-md-6">
+
+Use the <button>configure</button> button to customize graphic font, size, gridlines, and more.
+This can be helpful when exporting an image for publication.
+
+You can also find a link to configure the browser image by hovering over the
+"Genome Browser" drop-down menu.
+
+</div>
+</div>
+
+### Viewing the Reverse Strand
+
+<div class="row">
+<div class="col-md-6">
+
+By default, the UCSC Genome Browser displays the forward strand (5' to 3') but
+can be configured to display the negative strand (3' to 5').
+
+To reverse the genome orientation, click the <button>reverse</button> button, and the Genome
+Browser image will flip to show either the negative or positive strand.
+
+</div>
+<div class="col-md-6">
+
+<!--
+<img> here
+-->
+
+</div>
+</div>
+
+### Getting Help Using the Genome Browser
+
+<div class="row">
+<div class="col-md-6">
+
+<!--
+<img> here
+-->
+
+</div>
+<div class="col-md-6">
+
+The [training page](../training/) has other guides and training videos. You can
+also search the [mailing list archive](https://groups.google.com/a/soe.ucsc.edu/g/genome)
+for previously answered questions.
+
+If you still have questions after searching the [FAQ page](../FAQ/) or
+[Genome Browser User Guide](../goldenPath/help/hgTracksHelp.html) pages,
+you can email the suitable mailing list for your inquiry from the
+[Contact Us](../contacts.html) page.
+
+Follow our [citation guidelines](../cite.html) when using the Genome Browser
+tool suite or data from the UCSC Genome Browser database in a research work
+that will be published in a journal or on the Internet.
+
+In addition to the [relevant paper](goldenPath/pubs.html), please reference the Genome Browser website
+in your manuscript: *http://genome.ucsc.edu*.
+
+</div>
+</div>