25394954ec94f6bd219b4bab65330b3cb7250893
lrnassar
Mon Jan 20 11:49:06 2025 -0800
Fixing the basic tutorial link, refs #30335
diff --git docs/gb101.md docs/gb101.md
index 51f4ae5..b2889b9 100644
--- docs/gb101.md
+++ docs/gb101.md
@@ -1,306 +1,306 @@
---
title: "UCSC Genome Browser 101"
---
This tutorial is a basic introduction of the most common UCSC Genome Browser usage. This includes the
navigation menu, configuration of the tracks display, and where to find additional resources.
Explore each of the three section below to learn the material in a different form.
Browser Interface Annotated Screenshot
This 'cheat sheet' highlights and describes the main features and functionalities of
the tracks display.
Guided Workthrough
A guided workthrough that explains menu bar navigation,
as well as using and configuring the tracks display.
Interactive Tutorial
An interactive tutorial that covers the basic Browser introduction on this page.
The navigation bar at the top of the page will allow you to access our tools, downloads, and help pages.
There are five main drop-downs that are useful for most users:
- Genomes - switch between the many genomes available.
- Genome Browser - configure, search for tracks, and reset the Genome Browser back to the default settings.
- Tools - access to features such as [BLAT](../cgi-bin/hgBlat), [isPCR](../cgi-bin/hgPcr), and [LiftOver](../cgi-bin/hgLiftOver). The [Table Browser](../cgi-bin/hgTables) can also export track data in various file formats.
- My Data - create stable short links ([Sessions](../cgi-bin/hgSession)) and visualize your own data via [custom tracks](../cgi-bin/hgCustom) or [track hubs](../cgi-bin/hgHubConnect).
- Help - access contact information, FAQs, and Browser Documentation.
### Using the Search Box
The search bar allows you to navigate to a region on the genome using [genome coordinates](https://genome-blog.soe.ucsc.edu/blog/2016/12/12/the-ucsc-genome-browser-coordinate-counting-systems/),
[gene symbols](https://genome.ucsc.edu/FAQ/FAQgenes.html#genename),
[rsIDs](https://www.ncbi.nlm.nih.gov/snp/docs/RefSNP_about/#what-is-a-reference-snp),
[HGVS](http://varnomen.hgvs.org/) terms, or DNA sequence. You can even
search documentation and FAQ pages using this search bar. A few example queries
are:
- chr1:127140001-127140001
- SOD1
- rs2569190
- NM_198056.3:c.1654G>T
- CCTTCCTATAGTCCGGAATACGCC
AATGGCGCGGCCGGCCTGGACC
ACTCCCATTACGGGGGTGTCCC
GGGCAGCGGGGCCGGAGGCTTA
ATGCAAAGGC
Please note, [BLAT](https://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html#BLATAlign)
is used if your search term is a DNA sequence. For the best
results, make sure your sequence is long enough to meet BLAT specifications.
The [examples](https://genome.ucsc.edu/goldenPath/help/query.html)
link next to the search bar contains even more search queries.
Dragging the Genome Browser image performs different tasks depending on where and how you click the image.
Click-and-Drag the ruler at the top of the image will bring up a menu to zoom
into or highlight the region. Click-and-Drag anywhere else on the Genome
Browser image to scroll to the left or right.
Alternatively, you can:
- Hold **Alt+drag** or **Option+drag** to highlight
- Hold **Ctrl+drag** or **Cmd+drag** to zoom
### Configuring Data Track Display
Clicking on the rectangle box next to a track is an easy way to go to that
track's settings page quickly.
[Right-clicking](../goldenPath/help/hgTracksHelp.html#RIGHT_CLICK_NAV)
on the track will also bring up a menu to change the display
mode, configure a track, or view a PNG image of the current window.
Annotation tracks can be entirely hidden or shown in four different ways that
take an increasing amount of vertical space:
[dense, squish, pack, and full](../goldenPath/help/hgTracksHelp.html#TRACK_CONT).
*Pack display is the recommended visibility for most data types as it provides
the best balance of information and space.*
After changing a track's display mode, the change will not be applied until you
refresh the page. You can either refresh the page manually using your web
browser or click on any of the track groups.
### Searching for Data Tracks
Having trouble finding a dataset for your genome assembly? The
[Track Search](../cgi-bin/hgTracks?hgt_tSearch=track+search)
feature allows searching for terms in track names, descriptions, groups, and
ENCODE metadata.
More information about can be found on the following
[help page](../goldenPath/help/trackSearch.html). The Track Search feature can
also be accessed by hovering over the "Genome Browser" drop-down menu.
Use the button to customize graphic font, size, gridlines, and more.
This can be helpful when exporting an image for publication.
You can also find a link to configure the browser image by hovering over the
"Genome Browser" drop-down menu.
### Viewing the Reverse Strand
By default, the UCSC Genome Browser displays the forward strand (5' to 3') but
can be configured to display the negative strand (3' to 5').
To reverse the genome orientation, click the button, and the Genome
Browser image will flip to show either the negative or positive strand.
The [training page](../training/) has other guides and training videos. You can
also search the [mailing list archive](https://groups.google.com/a/soe.ucsc.edu/g/genome)
for previously answered questions.
If you still have questions after searching the [FAQ page](../FAQ/) or
[Genome Browser User Guide](../goldenPath/help/hgTracksHelp.html) pages,
you can email the suitable mailing list for your inquiry from the
[Contact Us](../contacts.html) page.
Follow our [citation guidelines](../cite.html) when using the Genome Browser
tool suite or data from the UCSC Genome Browser database in a research work
that will be published in a journal or on the Internet.
In addition to the [relevant paper](goldenPath/pubs.html), please reference the Genome Browser website
in your manuscript: *http://genome.ucsc.edu*.