36c90af395efb0985f7f840005cb1ff9640d9d16 lrnassar Mon Jan 20 09:19:13 2025 -0800 Additional tweaks to the new docs page, more details in the ticket. Refs #30335 diff --git docs/gb101.md docs/gb101.md index 9951b4e..51f4ae5 100644 --- docs/gb101.md +++ docs/gb101.md @@ -1,304 +1,306 @@ -% Introduction to the UCSC Genome Browser 101 +--- +title: "UCSC Genome Browser 101" +--- This tutorial is a basic introduction of the most common UCSC Genome Browser usage. This includes the navigation menu, configuration of the tracks display, and where to find additional resources. Explore each of the three section below to learn the material in a different form. <div class="row" style="padding-top: 15px"> <div class="col-md-4"> <div class="panel panel-default" style="padding-bottom: 10px"> <h3 class="panel-title" style="width: -webkit-fill-available;" >Browser Interface Annotated Screenshot</h3> This 'cheat sheet' highlights and describes the main features and functionalities of the tracks display. <p style="text-align: end"> -<button>[View](#annot-screenshot)</button> +<button>[View](#annotated-screenshot)</button> </p> </div> </div> <div class="col-md-4"> <div class="panel panel-default" style="padding-bottom: 10px"> <h3 class="panel-title" style="width: -webkit-fill-available;" >Guided Workthrough</h3> A guided workthrough that explains menu bar navigation, as well as using and configuring the tracks display. <p style="text-align: end"> -<button>[View](#guided-work)</button> +<button>[View](#guided-workthorugh)</button> </p> </div> </div> <div class="col-md-4"> <div class="panel panel-default" style="padding-bottom: 10px"> <h3 class="panel-title" style="width: -webkit-fill-available;" >Interactive Tutorial</h4> An interactive tutorial that covers the basic Browser introduction on this page. <p style="text-align: end"> <button>[View](../cgi-bin/hgTracks?#showTutorial)</button> </p> </div> </div> </div> ## Annotated Screenshot ```image src=../images/gb101cheatSheet.png width=90% ``` ## Guided Workthorugh ### Navigating the Menus <!-- We are going to use bootstrap columns to put the image/text side by side Alternate the images left/right between different sections, mostly for aesthetics ---> <div class="row"> <div class="col-md-6"> ```image src=../images/bluebarMenuGif.gif width=70% ``` </div> <div class="col-md-6"> The navigation bar at the top of the page will allow you to access our tools, downloads, and help pages. There are five main drop-downs that are useful for most users: - Genomes - switch between the many genomes available. - Genome Browser - configure, search for tracks, and reset the Genome Browser back to the default settings. - Tools - access to features such as [BLAT](../cgi-bin/hgBlat), [isPCR](../cgi-bin/hgPcr), and [LiftOver](../cgi-bin/hgLiftOver). The [Table Browser](../cgi-bin/hgTables) can also export track data in various file formats. - My Data - create stable short links ([Sessions](../cgi-bin/hgSession)) and visualize your own data via [custom tracks](../cgi-bin/hgCustom) or [track hubs](../cgi-bin/hgHubConnect). - Help - access contact information, FAQs, and Browser Documentation. </div> </div> ### Using the Search Box <div class="row"> <div class="col-md-6"> The search bar allows you to navigate to a region on the genome using [genome coordinates](https://genome-blog.soe.ucsc.edu/blog/2016/12/12/the-ucsc-genome-browser-coordinate-counting-systems/), [gene symbols](https://genome.ucsc.edu/FAQ/FAQgenes.html#genename), [rsIDs](https://www.ncbi.nlm.nih.gov/snp/docs/RefSNP_about/#what-is-a-reference-snp), [HGVS](http://varnomen.hgvs.org/) terms, or DNA sequence. You can even search documentation and FAQ pages using this search bar. A few example queries are: - chr1:127140001-127140001 - SOD1 - rs2569190 - NM_198056.3:c.1654G>T - CCTTCCTATAGTCCGGAATACGCC AATGGCGCGGCCGGCCTGGACC ACTCCCATTACGGGGGTGTCCC GGGCAGCGGGGCCGGAGGCTTA ATGCAAAGGC Please note, [BLAT](https://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html#BLATAlign) is used if your search term is a DNA sequence. For the best results, make sure your sequence is long enough to meet BLAT specifications. The [examples](https://genome.ucsc.edu/goldenPath/help/query.html) link next to the search bar contains even more search queries. </div> <div class="col-md-6"> <img src="../images/GeneSearch.jpg" alt="Genome selection" style="max-width:100%;"> </div> </div> ### Highlights and Zooming <div class="row"> <div class="col-md-6"> ```image src=../images/highlightZoomGif.gif width=100% ``` </div> <div class="col-md-6"> Dragging the Genome Browser image performs different tasks depending on where and how you click the image. Click-and-Drag the ruler at the top of the image will bring up a menu to zoom into or highlight the region. Click-and-Drag anywhere else on the Genome Browser image to scroll to the left or right. Alternatively, you can: - Hold **Alt+drag** or **Option+drag** to highlight - Hold **Ctrl+drag** or **Cmd+drag** to zoom </div> </div> ### Configuring Data Track Display <div class="row"> <div class="col-md-6"> Clicking on the rectangle box next to a track is an easy way to go to that track's settings page quickly. [Right-clicking](../goldenPath/help/hgTracksHelp.html#RIGHT_CLICK_NAV) on the track will also bring up a menu to change the display mode, configure a track, or view a PNG image of the current window. </div> <div class="col-md-6"> ```image src=../images/rightClickAndGreyBarGif.gif width=95% ``` </div> </div> ### Track Display Modes <div class="row"> <div class="col-md-6"> <!-- <img> here --> </div> <div class="col-md-6"> Annotation tracks can be entirely hidden or shown in four different ways that take an increasing amount of vertical space: [dense, squish, pack, and full](../goldenPath/help/hgTracksHelp.html#TRACK_CONT). *Pack display is the recommended visibility for most data types as it provides the best balance of information and space.* After changing a track's display mode, the change will not be applied until you refresh the page. You can either refresh the page manually using your web browser or click <button>refresh</button> on any of the track groups. </div> </div> ### Searching for Data Tracks <div class="row"> <div class="col-md-6"> Having trouble finding a dataset for your genome assembly? The [Track Search](../cgi-bin/hgTracks?hgt_tSearch=track+search) feature allows searching for terms in track names, descriptions, groups, and ENCODE metadata. More information about <button>track search</button> can be found on the following [help page](../goldenPath/help/trackSearch.html). The Track Search feature can also be accessed by hovering over the "Genome Browser" drop-down menu. </div> <div class="col-md-6"> <!-- <img> here --> </div> </div> ### Configuring the Genome Browser Display <div class="row"> <div class="col-md-6"> ```image src=../images/configureGif.gif width=90% ``` </div> <div class="col-md-6"> Use the <button>configure</button> button to customize graphic font, size, gridlines, and more. This can be helpful when exporting an image for publication. You can also find a link to configure the browser image by hovering over the "Genome Browser" drop-down menu. </div> </div> ### Viewing the Reverse Strand <div class="row"> <div class="col-md-6"> By default, the UCSC Genome Browser displays the forward strand (5' to 3') but can be configured to display the negative strand (3' to 5'). To reverse the genome orientation, click the <button>reverse</button> button, and the Genome Browser image will flip to show either the negative or positive strand. </div> <div class="col-md-6"> ```image src=../images/reverseStrand.png width=90% ``` </div> </div> ### Getting Help Using the Genome Browser <div class="row"> <div class="col-md-6"> ```image src=../images/gettingHelp.png width=40% ``` </div> <div class="col-md-6"> The [training page](../training/) has other guides and training videos. You can also search the [mailing list archive](https://groups.google.com/a/soe.ucsc.edu/g/genome) for previously answered questions. If you still have questions after searching the [FAQ page](../FAQ/) or [Genome Browser User Guide](../goldenPath/help/hgTracksHelp.html) pages, you can email the suitable mailing list for your inquiry from the [Contact Us](../contacts.html) page. Follow our [citation guidelines](../cite.html) when using the Genome Browser tool suite or data from the UCSC Genome Browser database in a research work that will be published in a journal or on the Internet. In addition to the [relevant paper](goldenPath/pubs.html), please reference the Genome Browser website in your manuscript: *http://genome.ucsc.edu*. </div> </div>