4fc10f8d260d0f77816cbadd6f64541b49bb272b mspeir Mon Jan 27 09:49:27 2025 -0800 adding images for new tutorial and tweaking makefile and lua file to including different bootstrap css file, refs #30335 diff --git docs/gb101.md docs/gb101.md index 7373822f0f7..040ca63e658 100644 --- docs/gb101.md +++ docs/gb101.md @@ -112,31 +112,34 @@ ACTCCCATTACGGGGGTGTCCC GGGCAGCGGGGCCGGAGGCTTA ATGCAAAGGC Please note, [BLAT](https://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html#BLATAlign) is used if your search term is a DNA sequence. For the best results, make sure your sequence is long enough to meet BLAT specifications. The [examples](https://genome.ucsc.edu/goldenPath/help/query.html) link next to the search bar contains even more search queries. </div> <div class="col-md-6"> -<img src="../images/GeneSearch.jpg" alt="Genome selection" style="max-width:100%;"> +```image +src=../images/hgTracksSearchBarExample.png +width=100% +``` </div> </div> --- ### Highlights and Zooming <div class="row"> <div class="col-md-6"> ```image src=../images/highlightZoomGif.gif width=100% ``` @@ -175,33 +178,34 @@ ```image src=../images/rightClickAndGreyBarGif.gif width=95% ``` </div> </div> --- ### Track Display Modes <div class="row"> <div class="col-md-6"> -<!-- -<img> here ---> +```image +src=../images/trackVisExamples.png +width=95% +``` </div> <div class="col-md-6"> Annotation tracks can be entirely hidden or shown in four different ways that take an increasing amount of vertical space: [dense, squish, pack, and full](../goldenPath/help/hgTracksHelp.html#TRACK_CONT). *Pack display is the recommended visibility for most data types as it provides the best balance of information and space.* After changing a track's display mode, the change will not be applied until you refresh the page. You can either refresh the page manually using your web browser or click <button>refresh</button> on any of the track groups. @@ -214,33 +218,34 @@ <div class="row"> <div class="col-md-6"> Having trouble finding a dataset for your genome assembly? The [Track Search](../cgi-bin/hgTracks?hgt_tSearch=track+search) feature allows searching for terms in track names, descriptions, groups, and ENCODE metadata. More information about <button>track search</button> can be found on the following [help page](../goldenPath/help/trackSearch.html). The Track Search feature can also be accessed by hovering over the "Genome Browser" drop-down menu. </div> <div class="col-md-6"> -<!-- -<img> here ---> +```image +src=../images/trackSearchSimpleExample.png +width=90% +``` </div> </div> --- ### Configuring the Genome Browser Display <div class="row"> <div class="col-md-6"> ```image src=../images/configureGif.gif width=90% ```