9dce2c252215de653e7674112ce47b0ca2f77eb9 gperez2 Mon Mar 17 17:40:17 2025 -0700 Adding a Sections bluebar, refs #34938 diff --git docs/gb101.md docs/gb101.md index 0307d3440fe..b10909fea90 100644 --- docs/gb101.md +++ docs/gb101.md @@ -1,318 +1,320 @@ --- title: "UCSC Genome Browser 101" --- This tutorial is a basic introduction of the most common UCSC Genome Browser usage. This includes the navigation menu, configuration of the tracks display, and where to find additional resources. +## Sections + Explore each of the three section below to learn the material in a different form. <div class="row" style="padding-top: 15px"> <div class="col-md-4"> <div class="panel panel-default" style="padding-bottom: 10px"> <h3 class="panel-title" style="width: -webkit-fill-available;" >Browser Interface Annotated Screenshot</h3> This 'cheat sheet' highlights and describes the main features and functionalities of the tracks display. <p style="text-align: end"> <button>[View](#annotated-screenshot)</button> </p> </div> </div> <div class="col-md-4"> <div class="panel panel-default" style="padding-bottom: 10px"> <h3 class="panel-title" style="width: -webkit-fill-available;" >Guided Workthrough</h3> A guided workthrough that explains menu bar navigation, as well as using and configuring the tracks display. <p style="text-align: end"> <button>[View](#guided-workthorugh)</button> </p> </div> </div> <div class="col-md-4"> <div class="panel panel-default" style="padding-bottom: 10px"> <h3 class="panel-title" style="width: -webkit-fill-available;" >Interactive Tutorial</h4> An interactive tutorial that covers the basic Browser introduction on this page. <p style="text-align: end"> <button>[View](../cgi-bin/hgTracks?startTutorial=true)</button> </p> </div> </div> </div> ## Annotated Screenshot ```image src=../images/gb101cheatSheet.png width=90% ``` ## Guided Workthorugh ### Navigating the Menus <!-- We are going to use bootstrap columns to put the image/text side by side Alternate the images left/right between different sections, mostly for aesthetics ---> <div class="row"> <div class="col-md-6"> ```image src=../images/bluebarMenuGif.gif width=70% ``` </div> <div class="col-md-6"> The navigation bar at the top of the page will allow you to access our tools, downloads, and help pages. There are five main drop-downs that are useful for most users: - Genomes - switch between the many genomes available. - Genome Browser - configure, search for tracks, and reset the Genome Browser back to the default settings. - Tools - access to features such as [BLAT](../cgi-bin/hgBlat), [isPCR](../cgi-bin/hgPcr), and [LiftOver](../cgi-bin/hgLiftOver). The [Table Browser](../cgi-bin/hgTables) can also export track data in various file formats. - My Data - create stable short links ([Sessions](../cgi-bin/hgSession)) and visualize your own data via [custom tracks](../cgi-bin/hgCustom) or [track hubs](../cgi-bin/hgHubConnect). - Help - access contact information, FAQs, and Browser Documentation. </div> </div> --- ### Using the Search Box <div class="row"> <div class="col-md-6"> The search bar allows you to navigate to a region on the genome using [genome coordinates](https://genome-blog.soe.ucsc.edu/blog/2016/12/12/the-ucsc-genome-browser-coordinate-counting-systems/), [gene symbols](https://genome.ucsc.edu/FAQ/FAQgenes.html#genename), [rsIDs](https://www.ncbi.nlm.nih.gov/snp/docs/RefSNP_about/#what-is-a-reference-snp), [HGVS](http://varnomen.hgvs.org/) terms, or DNA sequence. You can even search documentation and FAQ pages using this search bar. A few example queries are: - chr1:127140001-127140001 - SOD1 - rs2569190 - NM_198056.3:c.1654G>T - CCTTCCTATAGTCCGGAATACGCC AATGGCGCGGCCGGCCTGGACC ACTCCCATTACGGGGGTGTCCC GGGCAGCGGGGCCGGAGGCTTA ATGCAAAGGC Please note, [BLAT](https://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html#BLATAlign) is used if your search term is a DNA sequence. For the best results, make sure your sequence is long enough to meet BLAT specifications. The [examples](https://genome.ucsc.edu/goldenPath/help/query.html) link next to the search bar contains even more search queries. </div> <div class="col-md-6"> ```image src=../images/hgTracksSearchBarExample.png width=95% ``` </div> </div> --- ### Highlights and Zooming <div class="row"> <div class="col-md-6"> ```image src=../images/highlightZoomGif.gif width=100% ``` </div> <div class="col-md-6"> Dragging the Genome Browser image performs different tasks depending on where and how you click the image. Click-and-Drag the ruler at the top of the image will bring up a menu to zoom into or highlight the region. Click-and-Drag anywhere else on the Genome Browser image to scroll to the left or right. Alternatively, you can: - Hold **Alt+drag** or **Option+drag** to highlight - Hold **Ctrl+drag** or **Cmd+drag** to zoom </div> </div> --- ### Configuring Data Track Display <div class="row"> <div class="col-md-6"> Clicking on the rectangle box next to a track is an easy way to go to that track's settings page quickly. [Right-clicking](../goldenPath/help/hgTracksHelp.html#RIGHT_CLICK_NAV) on the track will also bring up a menu to change the display mode, configure a track, or view a PNG image of the current window. </div> <div class="col-md-6"> ```image src=../images/rightClickAndGreyBarGif.gif width=95% ``` </div> </div> --- ### Track Display Modes <div class="row"> <div class="col-md-6"> ```image src=../images/trackVisExamples.png width=95% ``` </div> <div class="col-md-6"> Annotation tracks can be entirely hidden or shown in four different ways that take an increasing amount of vertical space: [dense, squish, pack, and full](../goldenPath/help/hgTracksHelp.html#TRACK_CONT). *Pack display is the recommended visibility for most data types as it provides the best balance of information and space.* After changing a track's display mode, the change will not be applied until you refresh the page. You can either refresh the page manually using your web browser or click <button>refresh</button> on any of the track groups. </div> </div> --- ### Searching for Data Tracks <div class="row"> <div class="col-md-6"> Having trouble finding a dataset for your genome assembly? The [Track Search](../cgi-bin/hgTracks?hgt_tSearch=track+search) feature allows searching for terms in track names, descriptions, groups, and ENCODE metadata. More information about <button>track search</button> can be found on the following [help page](../goldenPath/help/trackSearch.html). The Track Search feature can also be accessed by hovering over the "Genome Browser" drop-down menu. </div> <div class="col-md-6"> ```image src=../images/trackSearchSimpleExample.png width=90% ``` </div> </div> --- ### Configuring the Genome Browser Display <div class="row"> <div class="col-md-6"> ```image src=../images/configureGif.gif width=90% ``` </div> <div class="col-md-6"> Use the <button>configure</button> button to customize graphic font, size, gridlines, and more. This can be helpful when exporting an image for publication. You can also find a link to configure the browser image by hovering over the "Genome Browser" drop-down menu. </div> </div> --- ### Viewing the Reverse Strand <div class="row"> <div class="col-md-6"> By default, the UCSC Genome Browser displays the forward strand (5' to 3') but can be configured to display the negative strand (3' to 5'). To reverse the genome orientation, click the <button>reverse</button> button, and the Genome Browser image will flip to show either the negative or positive strand. </div> <div class="col-md-6"> ```image src=../images/reverseStrand.png width=90% ``` </div> </div> --- ### Getting Help Using the Genome Browser <div class="row"> <div class="col-md-6"> ```image src=../images/gettingHelp.png width=40% ``` </div> <div class="col-md-6"> The [training page](../training/) has other guides and training videos. You can also search the [mailing list archive](https://groups.google.com/a/soe.ucsc.edu/g/genome) for previously answered questions. If you still have questions after searching the [FAQ page](../FAQ/) or [Genome Browser User Guide](../goldenPath/help/hgTracksHelp.html) pages, you can email the suitable mailing list for your inquiry from the [Contact Us](../contacts.html) page. Follow our [citation guidelines](../cite.html) when using the Genome Browser tool suite or data from the UCSC Genome Browser database in a research work that will be published in a journal or on the Internet. In addition to the [relevant paper](goldenPath/pubs.html), please reference the Genome Browser website in your manuscript: *http://genome.ucsc.edu*. </div> </div>