6d4b6f98a4144956ad7029bd7c1874ffd90fdf2f mspeir Wed Jul 8 09:23:00 2026 -0700 redoing slides as embedded html slide deck, refs #37292 diff --git docs/slideDecks/tutorial1-basics/presentation/index.html docs/slideDecks/tutorial1-basics/presentation/index.html new file mode 100644 index 00000000000..7c72b003cbd --- /dev/null +++ docs/slideDecks/tutorial1-basics/presentation/index.html @@ -0,0 +1,846 @@ + + + + + +UCSC Genome Browser · Tutorial 1: Basics + + + + + + + +
+ +
+ +
+

UCSC Genome Browser · Tutorial 1

+

The Basics

+

Getting oriented, navigating, tracks, and putting your own data on the Browser

+

A hands-on introduction · genome.ucsc.edu

+
+ +
+

How to follow along

+
    +
  • Examples are shown on human GRCh38 / hg38 throughout.
  • +
  • note markers flag what also applies to hg19 and other assemblies.
  • +
  • Examples are cancer / oncology-focused.
  • +
+
+
Try it Green = try it yourself.
+
Demo Blue = demo + follow along.
+
+
Open now + genome.ucsc.edu: keep this tab open.
+ +
+ +
+

What is the UCSC Genome Browser?

+
+
+
    +
  • A free web tool to view a genome and everything annotated on it, at any zoom.
  • +
  • Each row of data is a track; hundreds come pre-loaded per genome.
  • +
  • Add your own data and share a live view, both later in this tutorial.
  • +
  • Backed by databases at UCSC; nothing to install.
  • +
+
+
Genome Browser overview at BRAF +
Default view at BRAF (hg38): blue menu bar, search box, chromosome ideogram, and stacked tracks (genes, variants, expression, regulation, conservation).
+
+ +
+ +
+

The home page & the blue menu bar

+
+
+
    +
  • The blue menu bar appears on every page.
  • +
  • Genomes → jump to the Browser, or to the Gateway to pick an assembly.
  • +
  • Tools · My Data (your tracks & sessions) · Downloads · Help.
  • +
  • News on data/software changes & upcoming conferences.
  • +
+
Genomes drop-down menu +
The Genomes drop-down.
+
+
UCSC Genome Browser home page
+
+ +
+ +
+

The Gateway: pick an assembly & search

+
Genome Browser Gateway page +
The Gateway: choose a genome on the left, set the assembly and enter a gene / position / term on the right, then press GO.
+
+
    +
  • Left: popular species, a box to search thousands of assemblies, and your Recent Genomes and connected hub assemblies. “Show species tree” opens the full tree.
  • +
+
    +
  • Right: the assembly drop-down and a search box for a gene, position, or sequence. Over 50,000 assemblies in all.
  • +
  • We use hg38; hg19 is still common clinically — pick the right build first.
  • +
+
+
Try it + Genomes → Human GRCh38/hg38. Search BRAF, press Enter.
+ +
+ + +
+

The search box takes more than gene names

+
+
+
    +
  • Gene symbol: BRAF
  • +
  • A feature within a gene: SOX2 exon 2
  • +
  • Position: chr7:140,753,300-140,753,400
  • +
  • dbSNP: rs113488022 · HGVS: NM_004333.6:c.1799T>A
  • +
  • A pasted DNA sequence (runs BLAT)
  • +
  • ClinVar / RefSeq / GENCODE accessions
  • +
+
Two ways to search + Quick jump: pick the gene from the drop-down. Full search: press Enter / “Search” to scan all tracks & the whole site.
+

The “Examples” link by the box lists every accepted format.

+
+
Gateway search example for BRAF +
Searching BRAF: the quick-jump drop-down offers matches; pressing Enter runs a full search.
+
+ +
+ +
+

Navigation & viewing controls

+ + + +
+ +
+

Shift + drag to zoom or highlight

+
+
+
    +
  • Shift + drag across the image opens the Drag-and-select dialog: Zoom In to that range, or add a coloured highlight you can keep.
  • +
  • Alt-drag (Windows) / Option-drag (Mac) adds a highlight directly.
  • +
  • Ctrl-drag (Windows) / Cmd-drag (Mac) zooms straight to the selected range.
  • +
  • Clear highlights via View → Clear Highlights.
  • +
+
Try it + Shift-drag over a BRAF exon → Add Highlight, pick a colour.
+
+
Drag-and-select dialog +
Shift-drag → Drag-and-select: zoom to the region, or highlight it in a colour that persists across views.
+
+ +
+ +
+

Tracks & display

+
+ +
+

Tracks and display modes

+
+
+
    +
  • The track image is where every annotation is drawn.
  • +
  • Right-click a track for options: visibility, configure, reorder, hide others.
  • +
  • Each track controls its own height/detail via its visibility mode.
  • +
+
Try it + Right-click a track name to open its menu.
+
+
Right-click track menu +
The right-click menu: hide / dense / squish / pack / full, plus Hide all others, Move to top/bottom, Configure, View image.
+
+ +
+ +
+

Visibility modes: “feature” tracks

+
+
+
    +
  • hide: off
  • +
  • dense: all on one line
  • +
  • squish: thin, many per line
  • +
  • pack: one labelled item per row
  • +
  • full: one row per feature
  • +
+

Right-click a track to set its mode, configure, or reorder. (Same GENCODE region, four modes →)

+
+
+
densedense display mode
+
squishsquish display mode
+
packpack display mode
+
fullfull display mode
+
+
+ +
+ +
+

Visibility modes: “signal” tracks

+
+
+

Quantitative / “signal” tracks (wiggles, conservation, coverage) use the same menu; here it sets how the data is drawn:

+
    +
  • dense: single heat-style line
  • +
  • squish / pack: compact
  • +
  • full: full-height plot with a value axis
  • +
+
+
+
densesignal dense
+
squishsignal squish
+
packsignal pack
+
fullsignal full
+
+
+ +
+ +
+

Get information out of a track

+
+
+
    +
  • Mouse-over a feature for a quick tooltip.
  • +
  • Click a feature → details page (significance, links, colour key).
  • +
  • Click the track name → docs & configuration.
  • +
+
Try it, ▶ open the BRAF V600E session + Click the BRAF V600E ClinVar variant; read its details page. We work through this variant closely in Tutorial 3.
+
+
+
mouse-over (hover)ClinVar variant mouse-over tooltip
+
click → details pageClinVar details page for BRAF V600E
+
+
+ +
+ +
+

Mouse-over for quick descriptions

+
+
+
    +
  • Hover a track name (in the controls) → a one-line description of what it is.
  • +
  • Hover a feature → its key facts without clicking.
  • +
  • The fast way to learn an unfamiliar track before turning it on.
  • +
+
+
+
COSMIC track-name mouse-over
+
OMIM track-name mouse-over
+
+
+ +
+ +
+

Gene interpretation

+ + +
+
+

Zoom to bases, but BRAF is on the (–) strand

+
Genome bases C-A-T, codons do not match amino acid +
Genome reads C·A·T (left→right): it does not match the amino acid M. The displayed genome codons are wrong for a (–)-strand gene.
+
+
+

Click Reverse (below the image) → correct view

+
Reversed view: A-T-G = Met, start codon green +
Now it reads A·T·G = Met, the start codon highlighted green, codons line up with the protein.
+
+
+
Try it, ▶ open BRAF at the start codon + Zoom to bases, then hit Reverse to line up the codons.
+ +
+ +
+

Track groups = the menu of data (1/3)

+
+
+

Below the image, every track sits in a labelled group, your menu of data:

+
    +
  • Genes & Gene Predictions GENCODE, RefSeq, MANE
  • +
  • Phenotype, Variants & Literature ClinVar, COSMIC, CIViC…
  • +
  • Variation dbSNP, gnomAD
  • +
  • Expression · Single Cell · Regulation
  • +
  • Comparative Genomics · Repeats
  • +
+
+
Track controls with per-track visibility dropdowns +
The track-controls area under the image: each track has a visibility dropdown, organised by group. Don’t panic at the volume. The Recommended Track Sets (next) help.
+
+ +
+ +
+

A tour of the track groups (2/3)

+
+
+
    +
  • Mapping & Sequencing assembly, sequence, gaps, GC%
  • +
  • Genes & Gene Predictions GENCODE, NCBI RefSeq, MANE, Pfam domains, pseudogenes
  • +
  • Phenotype, Variants & Literature clinical / cancer DBs: ClinVar, COSMIC, HGMD…
  • +
+
+
+
    +
  • Variation observed variants, no disease claim: dbSNP, gnomAD
  • +
  • Human Pangenome (HPRC) alignments, references & variants from the pangenome project
  • +
+
+
+ +
+ +
+

A tour of the track groups (3/3)

+
+
+
    +
  • mRNA & EST older transcript-support assays
  • +
  • Expression RNA-seq & promoters: GTEx across tissues
  • +
  • Single Cell RNA-seq by tissue / cell type
  • +
+
+
+
    +
  • Regulation enhancers & promoters, largely from ENCODE
  • +
  • Comparative Genomics cross-species genome alignments & conservation
  • +
  • Repeats RepeatMasker, satellites, segmental dups
  • +
+
+
+
+ Note: not all track groups will be available for all assemblies, especially non-human and non-mouse +
+ +
+ +
+

Track documentation pages

+
+
+
    +
  • Reach it two ways: click the track's name in the controls under the image, or right-click the track → Configure.
  • +
  • Shows the track's description: data, methods & references, and the colour key.
  • +
  • The same page holds the track's settings (next slide).
  • +
+
Try it + Click the GENCODE track name; skim its description.
+
+
Track documentation page +
A track’s documentation page: methods, references, colour key, and configuration controls.
+
+ +
+ +
+

Container tracks: folders of subtracks

+
+
+
    +
  • Many entries (like NCBI RefSeq or GTEx) are really a group of related tracks — a single line in the controls that holds a set of subtracks.
  • +
  • Open the container (click its name, or right-click → Configure) to switch its subtracks on or off and set each one’s display mode.
  • +
  • Turn the container off to hide all its subtracks at once, or on to reveal them and choose individually.
  • +
+
Example + NCBI RefSeq is one container holding RefSeq Curated, Predicted, MANE, HGMD and more — here only RefSeq Curated is on.
+
+
NCBI RefSeq container track configuration with a checkbox list of subtracks +
A container track’s settings: check or uncheck each subtrack to choose what is drawn.
+
+ +
+ +
+

Configure a track: display & filters

+
ClinVar track configuration page with filters +
ClinVar’s settings page: the display mode, the boxed Filter items by controls, and colour options.
+
+
    +
  • Set the display mode (hide → full) and track colours.
  • +
  • Filter what’s shown — here by clinical significance, variant type, allele origin, molecular consequence, and size.
  • +
+
    +
  • Container tracks (a folder grouping related tracks) list their subtracks to switch on or off individually.
  • +
  • Submit applies your changes; Reset to defaults undoes them.
  • +
+
+
Try it + Open ClinVar’s settings and filter to Pathogenic variants only.
+ +
+ +
+

Reset all tracks

+
+
+
    +
  • Changed too many tracks and lost your place?
  • +
  • Genome Browser → Reset All User Settings restores the default set.
  • +
+
Note + Reset clears your track choices, custom tracks, and connected hubs (but not your saved sessions); gives you a clean slate.
+
+
Default tracks after reset +
After Reset All User Settings: the curated default set of tracks is back.
+
+ +
+ +
+

Viewing and extracting the DNA sequence

+
+
+
    +
  • Want the actual bases of a gene/region? View → DNA.
  • +
  • Returns the sequence for whatever is currently in view.
  • +
+
Try it + Zoom to a BRAF exon → View → DNA → Get DNA.
+
+
View menu → DNA Sequence +
View → DNA Sequence returns the bases for the current window.
+
+ +
+ +
+

Viewing DNA: options

+
DNA sequence output page +
The DNA output page: reverse-complement option, extension controls, and the retrieved sequence.
+
    +
  • Reverse complement for a (–)-strand gene, then Get DNA.
  • +
  • Extend the output up- / down-stream to grab flanking sequence.
  • +
  • Feeds primer design, BLAT, cloning…
  • +
+ +
+ +
+

Tools: Table Browser & BLAT

+

get the data out, and find a sequence in the genome

+
+ +
+

Table Browser: get the data out

+
+
+
    +
  • Tools → Table Browser: a graphical interface to all the underlying Genome Browser data.
  • +
  • Get the data behind any track, as a table.
  • +
  • Restrict to a region, filter by field, intersect two tracks.
  • +
  • Download BED/CSV, send to Galaxy, or save as a custom track.
  • +
+
Try it, ▶ open the BRCA2 ClinVar session + Export ClinVar variants in BRCA2, then intersect with GENCODE exons (or cCREs).
+
+
Table Browser form +
The Table Browser: pick a track (here ClinVar on BRCA1), add filters/intersections, choose an output format.
+
+ +
+ +
+

BLAT: find a sequence in a genome

+
+
+
    +
  • Tools → BLAT: paste DNA/protein → its location(s).
  • +
  • Place a read, a primer, or a sequence from a paper.
  • +
  • “Search all genomes” → where it lands in other species.
  • +
+
Try it, paste this BRAF fragment, Submit +
TGGAAAAATAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTAAAGGAAAACAGTAGATCTCATTTTCCTATCAGAGCAAGCA
+ ↓ scroll for the results
+
+
BLAT search page +
The BLAT page: paste a sequence, pick this genome (or all genomes), Submit.
+
+ +
+ +
+

BLAT: the results

+
BLAT results table +
Hits ranked by score & identity: our fragment hits BRAF on chr7 at ~100%. Click browser next to the top hit.
+ +
+ +
+

BLAT: your sequence aligned in the Browser

+
BLAT hit aligned on the browser +
“YourSeq” aligned over the BRAF coding sequence, codons & amino acids at base resolution.
+
    +
  • The query shows up as “YourSeq”, aligned to BRAF.
  • +
  • Re-run with “search all genomes” → the same sequence also hits other species (mouse and more).
  • +
+
Tools work cross-species + BLAT runs on mouse and any other assembly, with an identical workflow.
+ +
+ +
+

#1 goal: “visualise my own data”

+

Custom tracks

+

put your lab’s data on the Browser

+
+ +
+

What you can load

+
    +
  • Text: BED bedGraph GFF/GTF VCF WIG
  • +
  • Big binary (large data, by URL): bigBed bigWig BAM VCF+tabix .hic
  • +
  • Full list of accepted formats
  • +
+

Small data: paste it. Large data: host the file and give the Browser a URL.

+ +
+ +
+

Loading a custom track

+
+
+
    +
  1. My Data → Custom Tracks
  2. +
  3. Pick the assembly (hg38)
  4. +
  5. Paste a track line / file URL, or upload
  6. +
+
One-click examples: try now + ▶ Load a VCF of variants (hg19)
+ ▶ Load an RNA-seq bigWig (hg38)
+
Try it + Click the VCF example, then switch it dense ↔ full.
+
+
Loaded VCF custom track (1000 Genomes example, hg19) +
The UCSC example VCF (1000 Genomes, hg19) loaded as a custom track, genotypes shown as a haplotype tree over the variants.
+
+ +
+ +
+

Track hubs

+

many tracks, organised & shareable, by one URL

+
+ +
+

Hub vs custom track

+
    +
  • Custom track = a file or two; quick & personal.
  • +
  • Track hub = a structured, reusable collection of many tracks, configured once, loaded by one URL, ideal to publish or share with a lab.
  • +
+ +
+ +
+

Load a hub by URL

+
+
+
    +
  • My Data → Track Hubs → My Hubs → paste the hub URL.
  • +
  • Or browse Public Hubs and use Hub Search.
  • +
+
Demo: cancer & expression hubs + BRCA Exchange · ENCODE4 Regulation · FANTOM5 (multi-species).
+
Try it + Connect a hub by URL and turn on a track. Browse the Public Hubs page.
+
+
Track Data Hubs page +
The Track Data Hubs page: connect your own hub by URL, or browse hundreds of curated Public Hubs with Hub Search.
+
+ +
+ +
+

Build your own (in brief)

+
    +
  • Three text files: hub.txtgenomes.txttrackDb.txt, plus your big* data files.
  • +
  • Host anywhere reachable by URL; give the Browser the hub.txt link.
  • +
  • Full how-to: Track Hub Basics · take-away example file
  • +
+
New: free hosting: Hub Space 2026 + No web server? Upload bigBed / bigWig / BAM / VCF directly on the Browser: Track Hubs → Hub Space tab (10 GB to start — email us if you need more). Announcement →
+ +
+ +
+

Sessions: save & share

+

turn any view into a stable, shareable link

+
+ +
+

Sessions: save & share a live view

+
+
+
    +
  • My Data → My Sessions → name it → Submit.
  • +
  • Captures position, every track setting, your custom tracks & hubs.
  • +
  • Stable short link: genome.ucsc.edu/s/user/Name
  • +
+

Drop it into emails, papers, figure legends, posters, class handouts.

+
+
Public Sessions gallery +
Public Sessions: researchers share snapshots: each is a full Browser view (tracks, position, custom data) behind one link.
+
+ +
+ +
+

Sessions = collaboration & teaching

+
    +
  • Some of you want to teach with the Browser: a link gives every student the same starting view.
  • +
  • The BRCA·ENIGMA expert-panel set (Tutorial 3) shared its whole analysis as a session.
  • +
+
Try it + Save your current view as a session and copy its short link.
+ +
+ +
+

What you can now do

+
    +
  • Navigate the Browser and read any track & gene model.
  • +
  • Set track visibility, use the track groups, and reset to defaults.
  • +
  • Extract DNA, query the Table Browser, and place a sequence with BLAT.
  • +
  • Load your own data as custom tracks and hubs, and save & share a session.
  • +
+
Next + Tutorial 2 (Cancer Data) tours the clinical databases; Tutorial 3 puts them to work on real variants.
+
+ +
+

Where to get help

+ + +
+ +
+

Who are we?

+
+
+
    +
  • The UCSC Genome Browser, based in Santa Cruz, California.
  • +
  • Online since 2000.
  • +
  • A small team, building a free, public resource used worldwide.
  • +
+
Acknowledgement + Funded by the National Human Genome Research Institute (NHGRI) of the NIH.
+
+
UCSC Genome Browser team, July 2025 +
The UCSC Genome Browser team, July 2025.
+
+ +
+ +
+

Thank you!

+

Questions? · genome@soe.ucsc.edu

+

UCSC Genome Browser · genome.ucsc.edu

+
+ +
+
+ + + + + +