603a734862321da4d9bde067c47a4a13175acc02 mspeir Thu Jul 23 09:24:22 2026 -0700 Changes to slide decks based on CR; Adding reveal.js to source tree, rather than using CDN, refs #37874 #37904 diff --git docs/slideDecks/tutorial1-basics/presentation/index.html docs/slideDecks/tutorial1-basics/presentation/index.html index 7c72b003cbd..569bfc36ff5 100644 --- docs/slideDecks/tutorial1-basics/presentation/index.html +++ docs/slideDecks/tutorial1-basics/presentation/index.html @@ -1,846 +1,847 @@ UCSC Genome Browser · Tutorial 1: Basics - - + +

UCSC Genome Browser · Tutorial 1

The Basics

Getting oriented, navigating, tracks, and putting your own data on the Browser

A hands-on introduction · genome.ucsc.edu

How to follow along

  • Examples are shown on human GRCh38 / hg38 throughout.
  • note markers flag what also applies to hg19 and other assemblies.
  • Examples are cancer / oncology-focused.
Try it Green = try it yourself.
Demo Blue = demo + follow along.
Open now genome.ucsc.edu: keep this tab open.

What is the UCSC Genome Browser?

  • A free web tool to view a genome and everything annotated on it, at any zoom.
  • Each row of data is a track; hundreds come pre-loaded per genome.
  • Add your own data and share a live view, both later in this tutorial.
  • Backed by databases at UCSC; nothing to install.
Genome Browser overview at BRAF
Default view at BRAF (hg38): blue menu bar, search box, chromosome ideogram, and stacked tracks (genes, variants, expression, regulation, conservation).

The home page & the blue menu bar

  • The blue menu bar appears on every page.
  • Genomes → jump to the Browser, or to the Gateway to pick an assembly.
  • Tools · My Data (your tracks & sessions) · Downloads · Help.
  • News on data/software changes & upcoming conferences.
Genomes drop-down menu
The Genomes drop-down.
UCSC Genome Browser home page

The Gateway: pick an assembly & search

Genome Browser Gateway page
The Gateway: choose a genome on the left, set the assembly and enter a gene / position / term on the right, then press GO.
  • Left: popular species, a box to search thousands of assemblies, and your Recent Genomes and connected hub assemblies. “Show species tree” opens the full tree.
  • Right: the assembly drop-down and a search box for a gene, position, or sequence. Over 50,000 assemblies in all.
  • -
  • We use hg38; hg19 is still common clinically — pick the right build first.
  • +
  • We use hg38, but hg19 is still common clinically, so pick the right build first.
Try it Genomes → Human GRCh38/hg38. Search BRAF, press Enter.

The search box takes more than gene names

  • Gene symbol: BRAF
  • A feature within a gene: SOX2 exon 2
  • Position: chr7:140,753,300-140,753,400
  • -
  • dbSNP: rs113488022 · HGVS: NM_004333.6:c.1799T>A
  • +
  • dbSNP: rs113488022
  • +
  • HGVS: NM_004333.6:c.1799T>A
  • A pasted DNA sequence (runs BLAT)
  • ClinVar / RefSeq / GENCODE accessions
Two ways to search Quick jump: pick the gene from the drop-down. Full search: press Enter / “Search” to scan all tracks & the whole site.

The “Examples” link by the box lists every accepted format.

Gateway search example for BRAF
Searching BRAF: the quick-jump drop-down offers matches; pressing Enter runs a full search.

Navigation & viewing controls

Shift + drag to zoom or highlight

    -
  • Shift + drag across the image opens the Drag-and-select dialog: Zoom In to that range, or add a coloured highlight you can keep.
  • +
  • Shift + drag across the image opens the Drag-and-select dialog: Zoom In to that range, or add a colored highlight you can keep.
  • Alt-drag (Windows) / Option-drag (Mac) adds a highlight directly.
  • Ctrl-drag (Windows) / Cmd-drag (Mac) zooms straight to the selected range.
  • -
  • Clear highlights via View → Clear Highlights.
  • +
  • Clear highlights via View → Remove all highlights.
Try it - Shift-drag over a BRAF exon → Add Highlight, pick a colour.
+ Shift-drag over a BRAF exon → Add Highlight, pick a color.
Drag-and-select dialog -
Shift-drag → Drag-and-select: zoom to the region, or highlight it in a colour that persists across views.
+
Shift-drag → Drag-and-select: zoom to the region, or highlight it in a color that persists across views.

Tracks & display

Tracks and display modes

  • The track image is where every annotation is drawn.
  • Right-click a track for options: visibility, configure, reorder, hide others.
  • Each track controls its own height/detail via its visibility mode.
Try it Right-click a track name to open its menu.
Right-click track menu
The right-click menu: hide / dense / squish / pack / full, plus Hide all others, Move to top/bottom, Configure, View image.

Visibility modes: “feature” tracks

+

A feature is a single item drawn in a track, such as a gene, an exon, or a variant. Feature tracks draw these one at a time based on their chromosome start position, and the visibility mode sets how they stack:

  • hide: off
  • dense: all on one line
  • squish: thin, many per line
  • -
  • pack: one labelled item per row
  • +
  • pack: each row can contain multiple features
  • full: one row per feature

Right-click a track to set its mode, configure, or reorder. (Same GENCODE region, four modes →)

densedense display mode
squishsquish display mode
packpack display mode
fullfull display mode

Visibility modes: “signal” tracks

Quantitative / “signal” tracks (wiggles, conservation, coverage) use the same menu; here it sets how the data is drawn:

  • dense: single heat-style line
  • squish / pack: compact
  • full: full-height plot with a value axis
densesignal dense
squishsignal squish
packsignal pack
fullsignal full

Get information out of a track

  • Mouse-over a feature for a quick tooltip.
  • -
  • Click a feature → details page (significance, links, colour key).
  • +
  • Click a feature → details page (significance, links, color key).
  • Click the track name → docs & configuration.
Try it, ▶ open the BRAF V600E session Click the BRAF V600E ClinVar variant; read its details page. We work through this variant closely in Tutorial 3.
mouse-over (hover)ClinVar variant mouse-over tooltip
click → details pageClinVar details page for BRAF V600E
-

Mouse-over for quick descriptions

+

Mouse-over a track name for a description

    -
  • Hover a track name (in the controls) → a one-line description of what it is.
  • -
  • Hover a feature → its key facts without clicking.
  • -
  • The fast way to learn an unfamiliar track before turning it on.
  • +
  • Hover a track name in the controls under the image (not a feature in the image itself) → a one-line description of what that track is.
  • +
  • The fast way to learn an unfamiliar track before you turn it on.
COSMIC track-name mouse-over
OMIM track-name mouse-over

Gene interpretation

Zoom to bases, but BRAF is on the (–) strand

Genome bases C-A-T, codons do not match amino acid
Genome reads C·A·T (left→right): it does not match the amino acid M. The displayed genome codons are wrong for a (–)-strand gene.

Click Reverse (below the image) → correct view

Reversed view: A-T-G = Met, start codon green
Now it reads A·T·G = Met, the start codon highlighted green, codons line up with the protein.
Try it, ▶ open BRAF at the start codon Zoom to bases, then hit Reverse to line up the codons.

Track groups = the menu of data (1/3)

-

Below the image, every track sits in a labelled group, your menu of data:

+

Below the image, every track sits in a labeled group, your menu of data:

  • Genes & Gene Predictions GENCODE, RefSeq, MANE
  • Phenotype, Variants & Literature ClinVar, COSMIC, CIViC…
  • Variation dbSNP, gnomAD
  • Expression · Single Cell · Regulation
  • Comparative Genomics · Repeats
Track controls with per-track visibility dropdowns -
The track-controls area under the image: each track has a visibility dropdown, organised by group. Don’t panic at the volume. The Recommended Track Sets (next) help.
+
The track-controls area under the image: each track has a visibility dropdown, organized by group. Don’t panic at the volume. The Recommended Track Sets (next) help.

A tour of the track groups (2/3)

  • Mapping & Sequencing assembly, sequence, gaps, GC%
  • Genes & Gene Predictions GENCODE, NCBI RefSeq, MANE, Pfam domains, pseudogenes
  • Phenotype, Variants & Literature clinical / cancer DBs: ClinVar, COSMIC, HGMD…
  • Variation observed variants, no disease claim: dbSNP, gnomAD
  • Human Pangenome (HPRC) alignments, references & variants from the pangenome project

A tour of the track groups (3/3)

  • mRNA & EST older transcript-support assays
  • Expression RNA-seq & promoters: GTEx across tissues
  • Single Cell RNA-seq by tissue / cell type
  • Regulation enhancers & promoters, largely from ENCODE
  • Comparative Genomics cross-species genome alignments & conservation
  • Repeats RepeatMasker, satellites, segmental dups
Note: not all track groups will be available for all assemblies, especially non-human and non-mouse
- +

Track documentation pages

  • Reach it two ways: click the track's name in the controls under the image, or right-click the track → Configure.
  • -
  • Shows the track's description: data, methods & references, and the colour key.
  • +
  • Shows the track's description: data, methods & references, and the color key.
  • The same page holds the track's settings (next slide).
Try it Click the GENCODE track name; skim its description.
Track documentation page -
A track’s documentation page: methods, references, colour key, and configuration controls.
+
A track’s documentation page: methods, references, color key, and configuration controls.
- +

Container tracks: folders of subtracks

    -
  • Many entries (like NCBI RefSeq or GTEx) are really a group of related tracks — a single line in the controls that holds a set of subtracks.
  • +
  • Many entries (like NCBI RefSeq or GTEx) are really a group of related tracks: a single line in the controls that holds a set of subtracks.
  • Open the container (click its name, or right-click → Configure) to switch its subtracks on or off and set each one’s display mode.
  • Turn the container off to hide all its subtracks at once, or on to reveal them and choose individually.
Example - NCBI RefSeq is one container holding RefSeq Curated, Predicted, MANE, HGMD and more — here only RefSeq Curated is on.
+ NCBI RefSeq is one container holding RefSeq Curated, Predicted, MANE, HGMD and more. Here, only RefSeq Curated is on.
NCBI RefSeq container track configuration with a checkbox list of subtracks
A container track’s settings: check or uncheck each subtrack to choose what is drawn.

Configure a track: display & filters

ClinVar track configuration page with filters -
ClinVar’s settings page: the display mode, the boxed Filter items by controls, and colour options.
+
ClinVar’s settings page: the display mode and the boxed Filter items by controls.
    -
  • Set the display mode (hide → full) and track colours.
  • -
  • Filter what’s shown — here by clinical significance, variant type, allele origin, molecular consequence, and size.
  • +
  • Set the display mode (hide → full).
  • +
  • Filter what’s shown, here by clinical significance, variant type, allele origin, molecular consequence, and size.
  • Container tracks (a folder grouping related tracks) list their subtracks to switch on or off individually.
  • Submit applies your changes; Reset to defaults undoes them.
Try it Open ClinVar’s settings and filter to Pathogenic variants only.
- +

Reset all tracks

  • Changed too many tracks and lost your place?
  • Genome Browser → Reset All User Settings restores the default set.
Note Reset clears your track choices, custom tracks, and connected hubs (but not your saved sessions); gives you a clean slate.
Default tracks after reset
After Reset All User Settings: the curated default set of tracks is back.

Viewing and extracting the DNA sequence

  • Want the actual bases of a gene/region? View → DNA.
  • Returns the sequence for whatever is currently in view.
Try it Zoom to a BRAF exon → View → DNA → Get DNA.
View menu → DNA Sequence
View → DNA Sequence returns the bases for the current window.

Viewing DNA: options

DNA sequence output page
The DNA output page: reverse-complement option, extension controls, and the retrieved sequence.

Tools: Table Browser & BLAT

get the data out, and find a sequence in the genome

Table Browser: get the data out

  • Tools → Table Browser: a graphical interface to all the underlying Genome Browser data.
  • Get the data behind any track, as a table.
  • Restrict to a region, filter by field, intersect two tracks.
  • Download BED/CSV, send to Galaxy, or save as a custom track.
Try it, ▶ open the BRCA2 ClinVar session Export ClinVar variants in BRCA2, then intersect with GENCODE exons (or cCREs).
Table Browser form
The Table Browser: pick a track (here ClinVar on BRCA1), add filters/intersections, choose an output format.

BLAT: find a sequence in a genome

  • Tools → BLAT: paste DNA/protein → its location(s).
  • Place a read, a primer, or a sequence from a paper.
  • “Search all genomes” → where it lands in other species.
Try it, paste this BRAF fragment, Submit
TGGAAAAATAGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTAAAGGAAAACAGTAGATCTCATTTTCCTATCAGAGCAAGCA
↓ scroll for the results
BLAT search page
The BLAT page: paste a sequence, pick this genome (or all genomes), Submit.

BLAT: the results

BLAT results table
Hits ranked by score & identity: our fragment hits BRAF on chr7 at ~100%. Click browser next to the top hit.

BLAT: your sequence aligned in the Browser

BLAT hit aligned on the browser
“YourSeq” aligned over the BRAF coding sequence, codons & amino acids at base resolution.
Tools work cross-species BLAT runs on mouse and any other assembly, with an identical workflow.

#1 goal: “visualise my own data”

Custom tracks

put your lab’s data on the Browser

What you can load

Small data: paste it. Large data: host the file and give the Browser a URL.

Loading a custom track

  1. My Data → Custom Tracks
  2. Pick the assembly (hg38)
  3. Paste a track line / file URL, or upload
One-click examples: try nowLoad a VCF of variants (hg19)
Load an RNA-seq bigWig (hg38)
Try it Click the VCF example, then switch it dense ↔ full.
Loaded VCF custom track (1000 Genomes example, hg19)
The UCSC example VCF (1000 Genomes, hg19) loaded as a custom track, genotypes shown as a haplotype tree over the variants.

Track hubs

-

many tracks, organised & shareable, by one URL

+

many tracks, organized & shareable, by one URL

Hub vs custom track

Load a hub by URL

  • My Data → Track Hubs → My Hubs → paste the hub URL.
  • Or browse Public Hubs and use Hub Search.
Demo: cancer & expression hubs BRCA Exchange · ENCODE4 Regulation · FANTOM5 (multi-species).
Try it Connect a hub by URL and turn on a track. Browse the Public Hubs page.
Track Data Hubs page
The Track Data Hubs page: connect your own hub by URL, or browse hundreds of curated Public Hubs with Hub Search.

Build your own (in brief)

New: free hosting: Hub Space 2026 - No web server? Upload bigBed / bigWig / BAM / VCF directly on the Browser: Track Hubs → Hub Space tab (10 GB to start — email us if you need more). Announcement →
+ No web server? Upload bigBed / bigWig / BAM / VCF directly on the Browser: Track Hubs → Hub Space tab (10 GB to start; email us if you need more). Read the announcement.

Sessions: save & share

turn any view into a stable, shareable link

Sessions: save & share a live view

  • My Data → My Sessions → name it → Submit.
  • Captures position, every track setting, your custom tracks & hubs.
  • Stable short link: genome.ucsc.edu/s/user/Name

Drop it into emails, papers, figure legends, posters, class handouts.

Public Sessions gallery
Public Sessions: researchers share snapshots: each is a full Browser view (tracks, position, custom data) behind one link.

Sessions = collaboration & teaching

Try it Save your current view as a session and copy its short link.

What you can now do

Next Tutorial 2 (Cancer Data) tours the clinical databases; Tutorial 3 puts them to work on real variants.

Where to get help

Who are we?

  • The UCSC Genome Browser, based in Santa Cruz, California.
  • Online since 2000.
  • A small team, building a free, public resource used worldwide.
-
Acknowledgement +
Acknowledgment Funded by the National Human Genome Research Institute (NHGRI) of the NIH.
UCSC Genome Browser team, July 2025
The UCSC Genome Browser team, July 2025.

Thank you!

Questions? · genome@soe.ucsc.edu

UCSC Genome Browser · genome.ucsc.edu

- - + +