fd37b0cc737fd221a94034202db5458d954614eb
mspeir
  Mon Aug 3 14:50:37 2026 -0700
Fix mismatched heading tag in gb101 tutorial

The Interactive Tutorial panel opened an <h3> but closed with </h4>.

refs #37355

Co-Authored-By: Claude Opus 4.8 (1M context) <noreply@anthropic.com>

diff --git docs/tutorials/gb101.md docs/tutorials/gb101.md
index 5ea6f09d769..6b4fe5249c4 100644
--- docs/tutorials/gb101.md
+++ docs/tutorials/gb101.md
@@ -1,322 +1,322 @@
 ---
 title: "UCSC Genome Browser 101"
 ---
 
 This tutorial is a basic introduction of the most common UCSC Genome Browser usage. This includes the
 navigation menu, configuration of the tracks display, and where to find additional resources.
 
 ## Sections
 
 Explore each of the three section below to learn the material in a different form.
 
 <div class="row" style="padding-top: 15px">
 <div class="col-md-4">
 <div class="panel panel-default" style="padding-bottom: 10px">
 <h3 class="panel-title" style="width: -webkit-fill-available;"
 >Browser Interface Annotated Screenshot</h3>
 
 This 'cheat sheet' highlights and describes the main features and functionalities of
 the tracks display.
 
 <p style="text-align: end">
 <button>[View](#annotated-screenshot)</button>
 </p>
 </div>
 </div>
 
 <div class="col-md-4">
 <div class="panel panel-default" style="padding-bottom: 10px">
 <h3 class="panel-title" style="width: -webkit-fill-available;"
 >Guided Walkthrough</h3>
 
 A guided walkthrough that explains menu bar navigation, 
 as well as using and configuring the tracks display.
 
 <p style="text-align: end">
 <button>[View](#guided-walkthrough)</button>
 </p>
 </div>
 </div>
 
 <div class="col-md-4">
 <div class="panel panel-default" style="padding-bottom: 10px">
 <h3 class="panel-title" style="width: -webkit-fill-available;"
->Interactive Tutorial</h4>
+>Interactive Tutorial</h3>
 
 An interactive tutorial that covers the basic Browser introduction on this page.
 
 <p style="text-align: end">
 <button>[View](/cgi-bin/hgTracks?db=hg38&startTutorial=true)</button>
 </p>
 </div>
 </div>
 </div>
 
 ## Annotated Screenshot
 
 ```image
 src=/images/gb101cheatSheet.png
 width=90%
 ```
 
 ## Guided Walkthrough
 
 ### Navigating the Menus
 
 <!--
 We are going to use bootstrap columns to put the image/text side by side
 Alternate the images left/right between different sections, mostly for aesthetics
 --->
 
 <div class="row">
 <div class="col-md-6">
 
 ```image
 src=/images/bluebarMenuGif.gif
 width=70%
 ```
 
 </div>
 <div class="col-md-6">
 
 The navigation bar at the top of the page will allow you to access our tools, downloads, and help pages.
 
 Several of these drop-downs are useful for most users:
 
 - Genomes - switch between the many genomes available.
 - Genome Browser - configure, search for tracks, and reset the Genome Browser back to the default settings.
 - Tools - access to features such as [BLAT](/cgi-bin/hgBlat), [isPCR](/cgi-bin/hgPcr), and [LiftOver](/cgi-bin/hgLiftOver). The [Table Browser](/cgi-bin/hgTables) can also export track data in various file formats.
 - Downloads - download sequence and annotation data in bulk, along with our command-line utilities.
 - My Data - create stable short links ([Sessions](/cgi-bin/hgSession)) and visualize your own data via [custom tracks](/cgi-bin/hgCustom) or [track hubs](/cgi-bin/hgHubConnect).
 - View - save the current image as a PDF, get the DNA sequence for the window, or open the region in an external tool.
 - Help - access contact information, FAQs, and Browser Documentation.
 
 </div>
 </div>
 
 ---
 ### Using the Search Box
 
 <div class="row">
 <div class="col-md-6">
 
 The search bar allows you to navigate to a region on the genome using [genome coordinates](https://genome-blog.soe.ucsc.edu/blog/2016/12/12/the-ucsc-genome-browser-coordinate-counting-systems/),
 [gene symbols](https://genome.ucsc.edu/FAQ/FAQgenes.html#genename),
 [rsIDs](https://www.ncbi.nlm.nih.gov/snp/docs/RefSNP_about/#what-is-a-reference-snp),
 [HGVS](http://varnomen.hgvs.org/) terms, or DNA sequence. You can even
 search documentation and FAQ pages using this search bar. A few example queries
 are:
 
 - chr1:127140001-127140001
 - SOD1
 - rs2569190
 - NM_198056.3:c.1654G>T
 - CCTTCCTATAGTCCGGAATACGCC
 AATGGCGCGGCCGGCCTGGACC
 ACTCCCATTACGGGGGTGTCCC
 GGGCAGCGGGGCCGGAGGCTTA
 ATGCAAAGGC
 
 
 
 Please note, [BLAT](https://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html#BLATAlign)
 is used if your search term is a DNA sequence. For the best
 results, make sure your sequence is long enough to meet BLAT specifications.
 The [examples](https://genome.ucsc.edu/goldenPath/help/query.html)
 link next to the search bar contains even more search queries.
 
 </div>
 <div class="col-md-6">
 
 ```image
 src=/images/hgTracksSearchBarExample.png
 width=95%
 ```
 
 </div>
 </div>
 
 ---
 ### Highlights and Zooming
 
 <div class="row">
 <div class="col-md-6">
 
 ```image
 src=/images/highlightZoomGif.gif
 width=100%
 ```
 
 </div>
 <div class="col-md-6">
 
 Dragging the Genome Browser image performs different tasks depending on where and how you click the image.
 
 Click-and-Drag the ruler at the top of the image will bring up a menu to zoom
 into or highlight the region. Click-and-Drag anywhere else on the Genome
 Browser image to scroll to the left or right.
 
 Alternatively, you can:
 
 - Hold **Alt+drag** or **Option+drag** to highlight
 - Hold **Ctrl+drag** or **Cmd+drag** to zoom
 
 </div>
 </div>
 
 ---
 ### Configuring Data Track Display
 
 <div class="row">
 <div class="col-md-6">
 
 Clicking on the rectangle box next to a track is an easy way to go to that
 track's settings page quickly.
 
 [Right-clicking](/goldenPath/help/hgTracksHelp.html#RIGHT_CLICK_NAV)
 on the track will also bring up a menu to change the display
 mode, configure a track, or view a PNG image of the current window.
 
 </div>
 <div class="col-md-6">
 
 ```image
 src=/images/rightClickAndGreyBarGif.gif
 width=95%
 ```
 
 </div>
 </div>
 
 ---
 ### Track Display Modes
 
 <div class="row">
 <div class="col-md-6">
 
 ```image
 src=/images/trackVisExamples.png
 width=95%
 ```
 
 </div>
 <div class="col-md-6">
 
 Annotation tracks can be entirely hidden or shown in four different ways that
 take an increasing amount of vertical space: 
 [dense, squish, pack, and full](/goldenPath/help/hgTracksHelp.html#TRACK_CONT).
 
 *Pack display is the recommended visibility for most data types as it provides
 the best balance of information and space.*
 
 After changing a track's display mode, the change will not be applied until you
 refresh the page. You can either refresh the page manually using your web
 browser or click <button>refresh</button> on any of the track groups.
 
 </div>
 </div>
 
 ---
 ### Searching for Data Tracks
 
 <div class="row">
 <div class="col-md-6">
 
 Having trouble finding a dataset for your genome assembly? The 
 [Track Search](/cgi-bin/hgTracks?hgt_tSearch=track+search)
 feature allows searching for terms in track names, descriptions, groups, and
 ENCODE metadata.
 
 More information about <button>track search</button> can be found on the following
 [help page](/goldenPath/help/trackSearch.html). The Track Search feature can
 also be accessed by hovering over the "Genome Browser" drop-down menu.
 
 </div>
 <div class="col-md-6">
 
 ```image
 src=/images/trackSearchSimpleExample.png
 width=90%
 ```
 
 </div>
 </div>
 
 ---
 ### Configuring the Genome Browser Display
 
 <div class="row">
 <div class="col-md-6">
 
 ```image
 src=/images/configureGif.gif
 width=90%
 ```
 
 </div>
 <div class="col-md-6">
 
 Use the <button>configure</button> button to customize graphic font, size, gridlines, and more.
 This can be helpful when exporting an image for publication.
 
 You can also find a link to configure the browser image by hovering over the
 "Genome Browser" drop-down menu.
 
 </div>
 </div>
 
 ---
 ### Viewing the Reverse Strand
 
 <div class="row">
 <div class="col-md-6">
 
 By default, the UCSC Genome Browser displays the forward strand (5' to 3') but
 can be configured to display the negative strand (3' to 5').
 
 To reverse the genome orientation, click the <button>reverse</button> button, and the Genome
 Browser image will flip to show either the negative or positive strand.
 
 </div>
 <div class="col-md-6">
 
 ```image
 src=/images/reverseStrand.png
 width=90%
 ```
 
 </div>
 </div>
 
 ---
 ### Getting Help Using the Genome Browser
 
 <div class="row">
 <div class="col-md-6">
 
 ```image
 src=/images/gettingHelp.png
 width=40%
 ```
 
 </div>
 <div class="col-md-6">
 
 The [training page](/training/) has other guides and training videos. You can
 also search the [mailing list archive](https://groups.google.com/a/soe.ucsc.edu/g/genome)
 for previously answered questions.
 
 If you still have questions after searching the [FAQ page](/FAQ/) or
 [Genome Browser User Guide](/goldenPath/help/hgTracksHelp.html) pages,
 you can email the suitable mailing list for your inquiry from the
 [Contact Us](/contacts.html) page.
 
 Follow our [citation guidelines](/cite.html) when using the Genome Browser
 tool suite or data from the UCSC Genome Browser database in a research work
 that will be published in a journal or on the Internet.
 
 In addition to the [relevant paper](goldenPath/pubs.html), please reference the Genome Browser website
 in your manuscript: *http://genome.ucsc.edu*.
 
 </div>
 </div>