From the Genomes page, you can jump to the default position of an assembly by clicking the "Go" button or you can specify a particular genome position in a variety of formats. These same formats are valid in the search bar above the main Genome Browser track display.
In addition to the positional queries described below, any search term can be used to find matches in track data, track names and/or descriptions, help docs, and public hub track names and/or descriptions. See our search page for more details on the search functionality.
Valid position queries can include:
SYMBOL exon N or SYMBOL:e.N[+/-offset]
(e.g. TP53 exon 5, BRCA2:e.10, NM_000546:e.5+2)BRAF p.600, KAT6A p.495_533, KAT6A c.1483_1599)BRAF 600, KAT6A 495-533, KAT6A c.1483_1599)
To specify a genome position:
A query may have multiple results. If this is the case, a results page will appear listing
each result along with the track it is associated with. Once selected, the result will be displayed
in the Browser with a highlighted label, making it easier to identify. If you have further
questions, you can search the Genome Browser FAQ
page and find links to further resources. Also, developers of track hubs can create
searchable track hubs using the
searchTrix setting.
To jump directly to a specific exon, type the gene symbol or transcript ID followed by the exon number in one of two formats:
SYMBOL exon N — e.g. TP53 exon 5 or NM_000546 exon 5SYMBOL:e.N — compact notation from the
VICC Gene Fusion Specification,
e.g. TP53:e.5 or NM_000546:e.5. Optionally add an intronic offset:
SYMBOL:e.N+offset navigates offset bases past the 3’ end of the exon
(into the downstream intron), and SYMBOL:e.N-offset navigates offset bases
before the 5’ start (into the upstream intron). Useful for splice site inspection:
BRCA2:e.10+2 lands 2 bp into the intron after exon 10.
Exon numbering is 1-based and follows transcript order (exon 1 is the 5′ exon).
Genes are looked up in order: MANE, GENCODE/UCSC (knownGene),
all RefSeq, then historical RefSeq. To jump to a codon instead, just enter it
after the gene, e.g. BRAF 600, use the HGVS notation (see below), or
right-click any transcript in the browser and select “Zoom to
codon”.
A codon or nucleotide number can also be given as a range, which is often what you want when a
paper describes a variant or a domain that covers more than one codon. Write the two numbers with
an underscore between them, as HGVS does: KAT6A p.495_533 or
KAT6A c.1483_1599. The amino acid letters are optional, so
KAT6A p.Lys495_Ser533 works as well, and an Ensembl or RefSeq transcript can stand in
-for the gene symbol, e.g. ENST00000265713.8 p.495_533. A hyphen does not mean a range:
-in HGVS, c.1483-1599 is a position in the intron 1599 bases before
-c.1483, and the Browser reads it that way.
ENST00000265713.8 p.495_533.
+
+
+For codons you can use a hyphen instead of the underscore, so BRCA1 100-200 and
+KAT6A p.495-533 both work. This shortcut is for codons only. After
+c. or n. a hyphen keeps its HGVS meaning, which is an intron offset
+rather than a range: KAT6A c.1483-1599 is the single base 1599 bases before
+c.1483, deep in the preceding intron, and the Browser takes you there. So
+KAT6A 100-200 is a stretch of 101 codons, while KAT6A c.100-200 is one
+base. If you mean a range of nucleotides, always use the underscore.
Below is a list of examples that might be used to query the Genome Browser. Note that not every query listed here will produce a result in every assembly. The list serves only to illustrate the different types of queries that can be performed.
| Query | Genome Browser Response | |
|---|---|---|
| chr7 | Displays all of chromosome 7 | |
| chr3:1-1000000 | Displays the first million bases of chromosome 3, counting from the p-arm telomere | |
| 3:1-1000000 | Displays the first million bases of chromosome 3, Ensembl format chromosome names | |
| chr3 0 1000000 | Displays the first million bases of chromosome 3; BED format | |
| NC_000007.14:1-1000000 | Displays the first million bases of chromosome 3, RefSeq format | |
| CM000665.2:1-1000000 | Displays the first million bases of chromosome 3, GenBank/INSDC format | |
| chr3:1000000+2000 | Displays a region of chromosome 3 that spans 2000 bases, starting with position 1000000 | |
| chrUn_GL000213v1 | Displays all of the unplaced contig GL000213v1 | |
| chr3_GL000221v1_random | Displays the unlocalized contig GL000221v1 | |
| chr1_KN196472v1_fix | Displays all of patch fix KN196472v1 | |
| 20p13 | Displays the region for band p13 on chromosome 20 | |
| GTATGTAGCCACGGAGCACCATTACCTGTCACCATTACCTGAATGGCTA | Displays the first best match to this DNA sequence, e.g. chr21:33034835-33034883 for hg19 | |
| AA205474 | Displays the region containing the EST with GenBank accession AA205474 in the BRCA1 cancer gene on chromosome 17 | |
| AC008101 | Displays the region containing the clone with GenBank accession AC008101 | |
| AF083811 | Displays the region containing the mRNA with GenBank accession number AF083811 | |
| NM_017414 | Displays the region containing RefSeq identifier NM_017414 | |
| NP_059110 | Displays the region containing protein accession number NP_059110 | |
| PRNP | Displays the region containing HUGO Gene Nomenclature Committee identifier PRNP | |
| Q99697 | Displays the region containing the alignment of the UniProt/SwissProt protein sequence with accession Q99697 (PITX2) | |
| RH18061;RH80175 15q11;15q13 NM_012090.5;NM_012421.4 |
Displays the region between genome landmarks, such as the STS markers RH18061 and
RH80175, or chromosome bands 15q11 to 15q13, or SNPs NM_000310.4 and NM_012090.5. This syntax may also be used for other range queries, such as between uniquely determined ESTs, mRNAs, refSeqs, SNPS, etc. | |
| NR_026861.1:1-1000 | Works with any other type of accession from this page: Displays the first 1000bp of NR_026861.1 | |
| TP53 exon 5 NM_000546 exon 5 |
Jumps to exon 5 of TP53 using the verbose notation. A transcript ID (NM_, NR_, XM_, XR_, ENST) may be used in place of the gene symbol. | |
| TP53:e.5 NM_000546.6:e.5 BRCA2:e.10+2 BRCA2:e.10-3 |
Compact exon notation from the
VICC Gene Fusion Specification.
Jumps to exon 5 of TP53, or to 2 bp past the end / 3 bp before the start of BRCA2 exon 10
(useful for splice site inspection). The +N/-N offset is optional. | |
| NM_000310.4(PPT1):c.271_287del17insTT NM_007262.5(PARK7):c.-24+75_-24+92dup NM_006172.4(NPPA):c.456_*1delAA MYH11:c.503-14_503-12del NM_198576.4(AGRN):c.1057C>T NM_198056.3:c.1654G>T NP_002993.1:p.Asp92Glu NP_002993.1:p.D92E BRCA1 Ala744Cys BRCA1 A744C LRG_100t1:c.4G>A LRG_100t1:n.1 LRG_456p1:p.Ser190Leu LRG_321:g.16409_16461del ENST00000002596.6:c.-108-6848A>G ENSP00000005178.5:p.Val20Gly chrX:g.31500000_31600000del NR_111987:n.-1 NM_015102.5:n.3038-2 NM_001372044:c.1528_1530del |
Displays the region that matches the HGVS
expression, usually in the format <transcript or protein>:<position> <amino acid or nucleotide change> If a gene symbol is used, HGVS search will try all RefSeq transcripts to find the nucleotide or amino acid at the position indicated in the expression. If there are multiple matches, a disambiguation page will be shown. If the RefSeq sequence differs from the genome sequence, then currently the search will use the genome, not the transcript, for codon counting and amino acid / nucleotide comparison. Please contact us if this is inconvenient. | |
| KAT6A p.495 KAT6A p.495_533 KAT6A p.Lys495_Ser533 - ENST00000265713.8 p.495_533 NM_006766.5 p.495 KAT6A c.1483 - KAT6A c.1483_1599 ENST00000265713.8 c.1483_1599 |
+ KAT6A p.495 KAT6A 495 KAT6A p.495_533 KAT6A 495-533 + KAT6A p.Lys495_Ser533 ENST00000265713.8 p.495_533 NM_006766.5 p.495 + KAT6A c.1483 KAT6A c.1483_1599 ENST00000265713.8 c.1483_1599 |
A codon or nucleotide position, or a range of them, with no sequence change. The amino acid
- letters are optional and the gene symbol can be replaced by a RefSeq or Ensembl transcript.
- Note that the range separator is the underscore, as in HGVS; a hyphen means something else, so
- c.1483-1599 is read as a position in the intron 1599 bases before
- c.1483. A gene symbol with more than one transcript brings up a disambiguation
- page. |
| NM_198056.2:c.1A>C | An example of an HGVS search on a previous NM version that is now outdated. Support for previous NM accessions is only available on hg38. | |
| 1-55051215-G-GA | Displays the region that matches the gnomAD variant ID, 1-55051215-G-GA | |
| essv8694097 | Displays the region covering the copy number variant with the accession essv8694097 in the Database of Genomic Variants (DGV) | |
| nssv3446126 | Displays the region covering the copy number variant with the accession nssv3446126 in the cases of developmental delay | |
| CTD-3071L10 | Displays the region covering the CTD-3071L10 NCBI clone end mapping in the NCBI Clone DB database | |
| nssv16167444 | Displays the region covering the common copy number genomic variant with the accession nssv16167444 in the nstd186 (NCBI Curated Common Structural Variants) dataset | |
| rs1333049 | Displays results for annotations matching this rsID, including dbSNP database | |
| COSM6161404 | Displays the region covering COSM6161404 in the Catalogue Of Somatic Mutations In Cancer (COSMIC) database | |
| nssv3395351 | Displays the region covering ClinVar Copy Number Variant with the accession nssv3395351 in the ClinVar database | |
| BRCT_assoc | Displays the region covering the manually-curated Pfam-A domain BRCT_assoc found in GENCODE Genes | |
| U133A:219211_at | Displays the region containing the consensus and exemplar sequences used for the selection of probes on the Affymetrix HG-U133A chips | |
| chr1 0 1000 | When entered without ":" and "-", uses 0-based, half-open coordinates (like custom tracks and internal table coordinates), so displays chr1:1-1000 | |
| pseudogene mRNA | Lists transcribed pseudogenes, but not cDNAs | |
| p53 | Lists mRNAs related to the p53 tumor suppressor | |
| T-cell receptor | Lists mRNAs for T-cell receptor genes in GenBank | |
| breast cancer | Lists mRNAs associated with breast cancer | |
| homeobox caudal | Lists mRNAs for caudal homeobox genes | |
| zinc finger | Lists zinc finger mRNAs | |
| kruppel zinc finger | Lists only kruppel-like zinc fingers | |
| huntington | Lists candidate genes associated with Huntington's disease | |
| zahler | Lists mRNAs deposited by a scientist named Zahler | |
| Evans,J.E. | Lists mRNAs deposited by co-author J.E. Evans |
Use this last format for author queries. Although GenBank requires the search format Evans JE, internally it uses the format Evans,J.E..