715e2acf2dd9ef6106cc42ce79c724e1e52ad62e
braney
  Thu Mar 12 09:14:28 2026 -0700
NoDots MAF alignment display for hgc mafClick, with i-row preservation and mafFrag -noDots flag

hgMaf.c: add hgMafFragHelperNoDots and public wrappers (hgMafFragNoDots,
hgBigMafFragNoDots, hgMafFragFromMafListNoDots) that return a list of maf
blocks containing only species with actual sequence — no dot-filled rows.
Blocks are broken when the species set changes; gaps between same-species
blocks are filled with native sequence for the reference and dashes for
others.  Preserve i-row data (leftStatus/rightStatus/leftLen/rightLen)
through the NoDots path so insert annotations appear in emitted blocks.
hgMaf.h: declare the new NoDots public functions.
mafClick.c: use NoDots path when mafClickMafFrag is enabled.  Fix block
numbering (aliIx was never incremented in useMafFrag path).  Use full
textSize for NoDots line width.  Use dots instead of spaces in diff mode
for both paths.  Fix species label width computation to check labelHash
consistently so long assembly names don't misalign sequences.  Strip
ref gap columns where no other species has sequence.
mafFrag: add -noDots option to invoke hgMafFragNoDots from the command line,
with 4 new tests (noDots, noDotsRev, noDotsOutName, noDotsLarger).
refs #21477

Co-Authored-By: Claude Opus 4.6 <noreply@anthropic.com>

diff --git src/hg/ratStuff/mafFrag/tests/expected/noDotsRev.maf src/hg/ratStuff/mafFrag/tests/expected/noDotsRev.maf
new file mode 100644
index 00000000000..f61bd991934
--- /dev/null
+++ src/hg/ratStuff/mafFrag/tests/expected/noDotsRev.maf
@@ -0,0 +1,6 @@
+##maf version=1 scoring=zero
+a score=0.000000
+s hg38.chr1     11000 100 + 248956422 tttctgcgcgtgcacggcgccaccctccccccgccccagcccggcgccgtgcgactttgctcctgcaacacacgcccccccaacccccgcccgtaggctt
+s panTro4.chr15 13681  94 -  99548318 tttctgcgcctgcacggagcccacctgc-----ccccagacaggctccgtgcgactttgctcctgcaccacgcg-ccccgcaacccccgcccataggcgt
+i panTro4.chr15 N 0 C 0
+