715e2acf2dd9ef6106cc42ce79c724e1e52ad62e braney Thu Mar 12 09:14:28 2026 -0700 NoDots MAF alignment display for hgc mafClick, with i-row preservation and mafFrag -noDots flag hgMaf.c: add hgMafFragHelperNoDots and public wrappers (hgMafFragNoDots, hgBigMafFragNoDots, hgMafFragFromMafListNoDots) that return a list of maf blocks containing only species with actual sequence — no dot-filled rows. Blocks are broken when the species set changes; gaps between same-species blocks are filled with native sequence for the reference and dashes for others. Preserve i-row data (leftStatus/rightStatus/leftLen/rightLen) through the NoDots path so insert annotations appear in emitted blocks. hgMaf.h: declare the new NoDots public functions. mafClick.c: use NoDots path when mafClickMafFrag is enabled. Fix block numbering (aliIx was never incremented in useMafFrag path). Use full textSize for NoDots line width. Use dots instead of spaces in diff mode for both paths. Fix species label width computation to check labelHash consistently so long assembly names don't misalign sequences. Strip ref gap columns where no other species has sequence. mafFrag: add -noDots option to invoke hgMafFragNoDots from the command line, with 4 new tests (noDots, noDotsRev, noDotsOutName, noDotsLarger). refs #21477 Co-Authored-By: Claude Opus 4.6 diff --git src/hg/ratStuff/mafFrag/tests/expected/noDotsOutName.maf src/hg/ratStuff/mafFrag/tests/expected/noDotsOutName.maf new file mode 100644 index 00000000000..c64d9e9fd5f --- /dev/null +++ src/hg/ratStuff/mafFrag/tests/expected/noDotsOutName.maf @@ -0,0 +1,6 @@ +##maf version=1 scoring=zero +a score=0.000000 +s testSeq 0 100 + 100 aagcctacgggcgggggttgggggggcgtgtgttgcaggagcaaagtcgcacggcgccgggctggggcggggggagggtggcgccgtgcacgcgcagaaa +s panTro4.chr15 13681 94 - 99548318 acgcctatgggcgggggttgcgggg-cgcgtggtgcaggagcaaagtcgcacggagcctgtctgggg-----gcaggtgggctccgtgcaggcgcagaaa +i panTro4.chr15 N 0 C 0 +