198c9b8daecc44fbda6a6494c566c723920f030a lrnassar Wed Mar 11 18:25:21 2026 -0700 Fixing a few hundred clear typos with the help of Claude. Some are less important in code comments, but majority of them are in user-facing places. I manually approved 60%+ of the changes and didn't see any that were an incorrect suggestion, at worst it was potentially uncessesary, like a code comment having cant instead of can't. No RM. diff --git src/hg/hgBlat/hgBlat.c src/hg/hgBlat/hgBlat.c index 46dbfb2a0fa..33a09ad0845 100644 --- src/hg/hgBlat/hgBlat.c +++ src/hg/hgBlat/hgBlat.c @@ -708,31 +708,31 @@ printf("\n"); } jsInlineF( "var ct_blat = '';\n" "\n" "function buildBigPslCtSuccess (content, status)\n" - "{ // Finishes the succesful creation of blat ct bigPsl. Called by ajax return.\n" + "{ // Finishes the successful creation of blat ct bigPsl. Called by ajax return.\n" " // saves the ct name so it can be used later for rename or delete.\n" "\n" "var matchWord = '&table=';\n" "var ct_blatPos = content.indexOf(matchWord) + matchWord.length;\n" "\n" "if (ct_blatPos >= 0)\n" " {\n" " var ct_blatPosEnd = content.indexOf('\"', ct_blatPos);\n" " ct_blat = content.slice(ct_blatPos, ct_blatPosEnd);\n" " if (luckyLocation == '')\n" " {\n" " $('input[name=\""CT_SELECTED_TABLE_VAR"\"]')[0].value = ct_blat;\n" " $('input[name=\""CT_SELECTED_TABLE_VAR"\"]')[1].value = ct_blat;\n" " }\n" " }\n" @@ -2174,57 +2174,57 @@ "Paste in a query sequence to find its location in the\n" "genome. Multiple sequences may be searched \n" "if separated by lines starting with '>' followed by the sequence name.\n" "\n" "\n" ); puts("\n"); puts("
File Upload: "); puts("Rather than pasting a sequence, you can choose to upload a text file containing " "the sequence.
"); puts("Upload sequence: "); puts("

\n"); printf("%s", "

Only DNA sequences of 25,000 or fewer bases and protein or translated \n" -"sequence of 10000 or fewer letters will be processed. Up to 25 sequences\n" +"sequence of 10,000 or fewer letters will be processed. Up to 25 sequences\n" "can be submitted at the same time. The total limit for multiple sequence\n" "submissions is 50,000 bases or 25,000 letters.
A valid example " "is GTCCTCGGAACCAGGACCTCGGCGTGGCCTAGCG (human SOD1).\n

\n"); printf("%s", "

The Search all checkbox allows you to search all genomes at the same time. " "Search all is only available for default assemblies and attached hubs with dedicated BLAT servers. " "The new dynamic BLAT servers are not supported, and they are noted as skipped in the output. " "See our BLAT All FAQ for more information.\n" ); printf("

The All Results checkbox disables minimum matches filtering so all results are seen." " For example, with a human dna search, 20 is minimum matches required, based on the genome size, to filter out lower-quality results.\n" "This checkbox can be useful with short queries and with the tiny genomes of microorganisms. \n" ); printf("

If you are interested in programmatic BLAT use," " see our BLAT FAQ.

\n" ); if (hgPcrOk(db)) printf("

For locating PCR primers, use In-Silico PCR" " for best results instead of BLAT. " "To search for short sequences < 20bp only in the sequence shown on the Genome Browser, " "use our Short Sequence Match track. " - "If you are using the command line and want to search the entire genome, our command line tool findMotifs, from the " + "If you are using the command line and want to search the entire genome, try our command line tool findMotifs, from the " "utilities download page.

", db, cartSessionVarName(), cartSessionId(cart)); puts("\n"); printf("\n"); webNewSection("About BLAT"); printf( "

BLAT on DNA is designed to\n" "quickly find sequences of 95%% and greater similarity of length 25 bases or\n" "more. It may miss more divergent or shorter sequence alignments. It will find\n" "perfect sequence matches of 20 bases.\n" "BLAT on proteins finds sequences of 80%% and greater similarity of length 20 amino\n"