cc23b76a1f2c7dc6a29c227661bfb0ce4d20eb54 lrnassar Fri Sep 4 13:43:48 2026 -0700 BLAT page polish from QA: Load example button, corrected input limits, wording fixes. refs #37996 Load example is a chip-style button with a mouseover instead of a hyperlink. Removed the Show input limits modal; corrected the limits in hgTracksHelp.html, stale since 2013 (DNA is 75,000 bases per sequence and 187,500 combined, protein and translated 10,000 and 25,000), added a #blatLimits anchor and pointed the two over-limit BLAT warnings and the form at it. Genome selector: section title Target assembly, type-to-search hint in the dropdown, Shortcuts: label, input and Query type select sized to match. Similar tools sidebar uses house-style hyphens and corrects the findMotif name and description. Share and rename text now states link lifetimes accurately (snapshot links last years, only sessions are permanent). Alignment page buttons match .gbPill, summary strip spacing fixed, New BLAT search button demoted from primary. Documents blatResultsGroup in ex.hg.conf. diff --git src/hg/htdocs/goldenPath/help/hgTracksHelp.html src/hg/htdocs/goldenPath/help/hgTracksHelp.html index 66fa86666c0..c5d8dde2b0d 100755 --- src/hg/htdocs/goldenPath/help/hgTracksHelp.html +++ src/hg/htdocs/goldenPath/help/hgTracksHelp.html @@ -898,40 +898,42 @@
Header lines may be included in the input text if they are preceded by > and contain unique names. Multiple sequences may be submitted at the same time if they are of the same type and are preceded by unique header lines. Numbers, spaces, and extraneous characters are ignored:
>sequence_1
ATGCAGAGCAAGGTGCTGCTGGCCGTCGCCCTGTGGCTCTGCGTGGAGAC
CCGGGCCGCCTCTGTGGGTTTGCCTAGTGTTTCTCTTGATCTGCCCAGGC
>sequence_2
ATGTTGTTTACCGTAAGCTGTAGTAAAATGAGCTCGATTGTTGACAGAGA
TGACAGTAGTATTTTTGATGGGTTGGTGGAAGAAGATGACAAGGACAAAG
>sequence_3
ATGCTGCGAACAGAGAGCTGCCGCCCCAGGTCGCCCGCCGGACAGGTGGC
CGCGGCGTCCCCGCTCCTGCTGCTGCTGCTGCTGCTCGCCTGGTGCGCGG
+
-DNA input sequences are limited to a maximum length of 25,000 bases. Protein or translated input -sequences must not exceed 10,000 letters. As many as 25 multiple sequences may be submitted at the -same time. The maximum combined length of DNA input for multiple sequence submissions is 50,000 -bases (with a 25,000 base limit per individual sequence). For protein or translated input, the -maximum combined input length is 25,000 letters (with a 5000 letter limit per individual -sequence).
+DNA input sequences are limited to a maximum length of 75,000 bases per sequence. Protein or +translated input sequences must not exceed 10,000 letters per sequence. As many as 25 sequences +may be submitted at the same time. The maximum combined length of a multiple-sequence submission +is 187,500 bases for DNA input and 25,000 letters for protein or translated input.-NOTE: Program-driven BLAT use is limited to a maximum of one hit every 15 seconds and no more than +For jobs above these limits, you can run BLAT on your own machine with the command-line tool; see +Running BLAT locally in the BLAT FAQ.
++NOTE: Program-driven BLAT use is limited to a maximum of one hit every 15 seconds and no more than 5000 hits per day.
If a query returns successfully, BLAT will display a flat database file that summarizes the alignments found. A BLAT query often generates multiple hits. This can happen when the genome contains multiple copies of a sequence, paralogs, pseudogenes, statistical coincidences, artifactual assembly duplications, or when the query itself contains repeats or common retrotransposons. When too many hits occur, try resubmitting the query sequence after filtering in slow mode with RepeatMasker.
Items in the search results list are ordered by the criteria specified in the Sort output menu. Each line item provides links to view the details of the sequence alignment or to open the corresponding view in the Genome Browser. The details link gives the letter-by-letter alignment of the sequence to the genome. It is recommended that you first examine the details of the