82b12a5fae1c82dffe13401e09749849d116e724
lrnassar
  Fri Dec 5 17:27:44 2025 -0800
Making major changes to the markdown /docs/ directory since we are going to keep adding to it. Starting with adding more heirarchy, also had to update the makefile and staticPage.lua to reference the correct root path for the CSS. Also had to update all of the relative links in the pages so far in order to make them absolute paths for easier implementation. Lastly, adding the new hubBasics page which is the first in the new hubs subdir. Refs #28347

diff --git docs/gb101.md docs/tutorials/gb101.md
similarity index 82%
rename from docs/gb101.md
rename to docs/tutorials/gb101.md
index 2161a4265ef..eeed5c0e0da 100644
--- docs/gb101.md
+++ docs/tutorials/gb101.md
@@ -1,320 +1,320 @@
 ---
 title: "UCSC Genome Browser 101"
 ---
 
 This tutorial is a basic introduction of the most common UCSC Genome Browser usage. This includes the
 navigation menu, configuration of the tracks display, and where to find additional resources.
 
 ## Sections
 
 Explore each of the three section below to learn the material in a different form.
 
 <div class="row" style="padding-top: 15px">
 <div class="col-md-4">
 <div class="panel panel-default" style="padding-bottom: 10px">
 <h3 class="panel-title" style="width: -webkit-fill-available;"
 >Browser Interface Annotated Screenshot</h3>
 
 This 'cheat sheet' highlights and describes the main features and functionalities of
 the tracks display.
 
 <p style="text-align: end">
 <button>[View](#annotated-screenshot)</button>
 </p>
 </div>
 </div>
 
 <div class="col-md-4">
 <div class="panel panel-default" style="padding-bottom: 10px">
 <h3 class="panel-title" style="width: -webkit-fill-available;"
 >Guided Walkthrough</h3>
 
 A guided walkthrough that explains menu bar navigation, 
 as well as using and configuring the tracks display.
 
 <p style="text-align: end">
 <button>[View](#guided-walkthrough)</button>
 </p>
 </div>
 </div>
 
 <div class="col-md-4">
 <div class="panel panel-default" style="padding-bottom: 10px">
 <h3 class="panel-title" style="width: -webkit-fill-available;"
 >Interactive Tutorial</h4>
 
 An interactive tutorial that covers the basic Browser introduction on this page.
 
 <p style="text-align: end">
-<button>[View](../cgi-bin/hgTracks?db=hg38&startTutorial=true)</button>
+<button>[View](/cgi-bin/hgTracks?db=hg38&startTutorial=true)</button>
 </p>
 </div>
 </div>
 </div>
 
 ## Annotated Screenshot
 
 ```image
-src=../images/gb101cheatSheet.png
+src=/images/gb101cheatSheet.png
 width=90%
 ```
 
 ## Guided Walkthrough
 
 ### Navigating the Menus
 
 <!--
 We are going to use bootstrap columns to put the image/text side by side
 Alternate the images left/right between different sections, mostly for aesthetics
 --->
 
 <div class="row">
 <div class="col-md-6">
 
 ```image
-src=../images/bluebarMenuGif.gif
+src=/images/bluebarMenuGif.gif
 width=70%
 ```
 
 </div>
 <div class="col-md-6">
 
 The navigation bar at the top of the page will allow you to access our tools, downloads, and help pages.
 
 There are five main drop-downs that are useful for most users:
 
 - Genomes - switch between the many genomes available.
 - Genome Browser - configure, search for tracks, and reset the Genome Browser back to the default settings.
-- Tools - access to features such as [BLAT](../cgi-bin/hgBlat), [isPCR](../cgi-bin/hgPcr), and [LiftOver](../cgi-bin/hgLiftOver). The [Table Browser](../cgi-bin/hgTables) can also export track data in various file formats.
-- My Data - create stable short links ([Sessions](../cgi-bin/hgSession)) and visualize your own data via [custom tracks](../cgi-bin/hgCustom) or [track hubs](../cgi-bin/hgHubConnect).
+- Tools - access to features such as [BLAT](/cgi-bin/hgBlat), [isPCR](/cgi-bin/hgPcr), and [LiftOver](/cgi-bin/hgLiftOver). The [Table Browser](/cgi-bin/hgTables) can also export track data in various file formats.
+- My Data - create stable short links ([Sessions](/cgi-bin/hgSession)) and visualize your own data via [custom tracks](/cgi-bin/hgCustom) or [track hubs](/cgi-bin/hgHubConnect).
 - Help - access contact information, FAQs, and Browser Documentation.
 
 </div>
 </div>
 
 ---
 ### Using the Search Box
 
 <div class="row">
 <div class="col-md-6">
 
 The search bar allows you to navigate to a region on the genome using [genome coordinates](https://genome-blog.soe.ucsc.edu/blog/2016/12/12/the-ucsc-genome-browser-coordinate-counting-systems/),
 [gene symbols](https://genome.ucsc.edu/FAQ/FAQgenes.html#genename),
 [rsIDs](https://www.ncbi.nlm.nih.gov/snp/docs/RefSNP_about/#what-is-a-reference-snp),
 [HGVS](http://varnomen.hgvs.org/) terms, or DNA sequence. You can even
 search documentation and FAQ pages using this search bar. A few example queries
 are:
 
 - chr1:127140001-127140001
 - SOD1
 - rs2569190
 - NM_198056.3:c.1654G>T
 - CCTTCCTATAGTCCGGAATACGCC
 AATGGCGCGGCCGGCCTGGACC
 ACTCCCATTACGGGGGTGTCCC
 GGGCAGCGGGGCCGGAGGCTTA
 ATGCAAAGGC
 
 
 
 Please note, [BLAT](https://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html#BLATAlign)
 is used if your search term is a DNA sequence. For the best
 results, make sure your sequence is long enough to meet BLAT specifications.
 The [examples](https://genome.ucsc.edu/goldenPath/help/query.html)
 link next to the search bar contains even more search queries.
 
 </div>
 <div class="col-md-6">
 
 ```image
-src=../images/hgTracksSearchBarExample.png
+src=/images/hgTracksSearchBarExample.png
 width=95%
 ```
 
 </div>
 </div>
 
 ---
 ### Highlights and Zooming
 
 <div class="row">
 <div class="col-md-6">
 
 ```image
-src=../images/highlightZoomGif.gif
+src=/images/highlightZoomGif.gif
 width=100%
 ```
 
 </div>
 <div class="col-md-6">
 
 Dragging the Genome Browser image performs different tasks depending on where and how you click the image.
 
 Click-and-Drag the ruler at the top of the image will bring up a menu to zoom
 into or highlight the region. Click-and-Drag anywhere else on the Genome
 Browser image to scroll to the left or right.
 
 Alternatively, you can:
 
 - Hold **Alt+drag** or **Option+drag** to highlight
 - Hold **Ctrl+drag** or **Cmd+drag** to zoom
 
 </div>
 </div>
 
 ---
 ### Configuring Data Track Display
 
 <div class="row">
 <div class="col-md-6">
 
 Clicking on the rectangle box next to a track is an easy way to go to that
 track's settings page quickly.
 
-[Right-clicking](../goldenPath/help/hgTracksHelp.html#RIGHT_CLICK_NAV)
+[Right-clicking](/goldenPath/help/hgTracksHelp.html#RIGHT_CLICK_NAV)
 on the track will also bring up a menu to change the display
 mode, configure a track, or view a PNG image of the current window.
 
 </div>
 <div class="col-md-6">
 
 ```image
-src=../images/rightClickAndGreyBarGif.gif
+src=/images/rightClickAndGreyBarGif.gif
 width=95%
 ```
 
 </div>
 </div>
 
 ---
 ### Track Display Modes
 
 <div class="row">
 <div class="col-md-6">
 
 ```image
-src=../images/trackVisExamples.png
+src=/images/trackVisExamples.png
 width=95%
 ```
 
 </div>
 <div class="col-md-6">
 
 Annotation tracks can be entirely hidden or shown in four different ways that
 take an increasing amount of vertical space: 
-[dense, squish, pack, and full](../goldenPath/help/hgTracksHelp.html#TRACK_CONT).
+[dense, squish, squish, and full](/goldenPath/help/hgTracksHelp.html#TRACK_CONT).
 
 *Pack display is the recommended visibility for most data types as it provides
 the best balance of information and space.*
 
 After changing a track's display mode, the change will not be applied until you
 refresh the page. You can either refresh the page manually using your web
 browser or click <button>refresh</button> on any of the track groups.
 
 </div>
 </div>
 
 ---
 ### Searching for Data Tracks
 
 <div class="row">
 <div class="col-md-6">
 
 Having trouble finding a dataset for your genome assembly? The 
-[Track Search](../cgi-bin/hgTracks?hgt_tSearch=track+search)
+[Track Search](/cgi-bin/hgTracks?hgt_tSearch=track+search)
 feature allows searching for terms in track names, descriptions, groups, and
 ENCODE metadata.
 
 More information about <button>track search</button> can be found on the following
-[help page](../goldenPath/help/trackSearch.html). The Track Search feature can
+[help page](/goldenPath/help/trackSearch.html). The Track Search feature can
 also be accessed by hovering over the "Genome Browser" drop-down menu.
 
 </div>
 <div class="col-md-6">
 
 ```image
-src=../images/trackSearchSimpleExample.png
+src=/images/trackSearchSimpleExample.png
 width=90%
 ```
 
 </div>
 </div>
 
 ---
 ### Configuring the Genome Browser Display
 
 <div class="row">
 <div class="col-md-6">
 
 ```image
-src=../images/configureGif.gif
+src=/images/configureGif.gif
 width=90%
 ```
 
 </div>
 <div class="col-md-6">
 
 Use the <button>configure</button> button to customize graphic font, size, gridlines, and more.
 This can be helpful when exporting an image for publication.
 
 You can also find a link to configure the browser image by hovering over the
 "Genome Browser" drop-down menu.
 
 </div>
 </div>
 
 ---
 ### Viewing the Reverse Strand
 
 <div class="row">
 <div class="col-md-6">
 
 By default, the UCSC Genome Browser displays the forward strand (5' to 3') but
 can be configured to display the negative strand (3' to 5').
 
 To reverse the genome orientation, click the <button>reverse</button> button, and the Genome
 Browser image will flip to show either the negative or positive strand.
 
 </div>
 <div class="col-md-6">
 
 ```image
-src=../images/reverseStrand.png
+src=/images/reverseStrand.png
 width=90%
 ```
 
 </div>
 </div>
 
 ---
 ### Getting Help Using the Genome Browser
 
 <div class="row">
 <div class="col-md-6">
 
 ```image
-src=../images/gettingHelp.png
+src=/images/gettingHelp.png
 width=40%
 ```
 
 </div>
 <div class="col-md-6">
 
-The [training page](../training/) has other guides and training videos. You can
+The [training page](/training/) has other guides and training videos. You can
 also search the [mailing list archive](https://groups.google.com/a/soe.ucsc.edu/g/genome)
 for previously answered questions.
 
-If you still have questions after searching the [FAQ page](../FAQ/) or
-[Genome Browser User Guide](../goldenPath/help/hgTracksHelp.html) pages,
+If you still have questions after searching the [FAQ page](/FAQ/) or
+[Genome Browser User Guide](/goldenPath/help/hgTracksHelp.html) pages,
 you can email the suitable mailing list for your inquiry from the
-[Contact Us](../contacts.html) page.
+[Contact Us](/contacts.html) page.
 
-Follow our [citation guidelines](../cite.html) when using the Genome Browser
+Follow our [citation guidelines](/cite.html) when using the Genome Browser
 tool suite or data from the UCSC Genome Browser database in a research work
 that will be published in a journal or on the Internet.
 
 In addition to the [relevant paper](goldenPath/pubs.html), please reference the Genome Browser website
 in your manuscript: *http://genome.ucsc.edu*.
 
 </div>
 </div>