bbabbd5d2566d47d923d51dbe350634783455999
mspeir
  Sun Oct 26 12:14:52 2025 -0700
change soe to gi, refs #35031

diff --git src/hg/htdocs/goldenPath/help/twoBit.html src/hg/htdocs/goldenPath/help/twoBit.html
index a7eb4cb2ae5..c8e04804fcf 100755
--- src/hg/htdocs/goldenPath/help/twoBit.html
+++ src/hg/htdocs/goldenPath/help/twoBit.html
@@ -4,58 +4,58 @@
 
 <!-- Relative paths to support mirror sites with non-standard GB docs install -->
 <!--#include virtual="$ROOT/inc/gbPageStart.html" -->
 
 <h1>TwoBit Sequence Archives</h1> 
 <p>
 A twoBit file is a highly efficient way to store genomic sequence. The format is defined 
 <a href="http://genome.ucsc.edu/FAQ/FAQformat.html#format7">here</a>. Note that lower-case 
 nucleotides are considered masked in twoBit, which can cause such sequence to be ignored when 
 using the <code>-mask</code> option with <code>gfServer</code>; therefore, you may wish to
 convert lower-case sequence to upper-case when preparing the FASTA format.</p>
 <p>
 To complete the steps below you must first download the <code>faToTwoBit</code>,
 <code>twoBitInfo</code>, and <code>twoBitToFa</code> utilities. For more information on downloading 
 our command-line utilities, see these 
-<A href="http://hgdownload.soe.ucsc.edu/downloads.html#source_downloads">instructions</a>.</p>
+<A href="http://hgdownload.gi.ucsc.edu/downloads.html#source_downloads">instructions</a>.</p>
 <p>
 To create a twoBit file, follow these steps:
 <ol>
   <li>
   Prepare the sequence for your twoBit file in a FASTA-formatted file (i.e. genome.fa).</li>
   <li>
   Run the <code>faToTwoBit</code> program on your FASTA file: 
   <pre><code>    faToTwoBit genome.fa genome.2bit</code></pre></li>
   <li>
   Use <code>twoBitInfo</code> to verify the sequences in this assembly and create a chrom.sizes 
   file, which is useful to construct the big* files in later processing steps:<br>
   <pre><code>    twoBitInfo genome.2bit stdout | sort -k2rn > genome.chrom.sizes</code></pre></li>
 </ol>
 <p>
 The twoBit commands can function with the .2bit file as a URL: 
 <pre><code>    twoBitInfo -udcDir=. http://your-website.edu/~user/genome.2bit | sort -k2nr > genome.chrom.sizes</code></pre></p>
 <p>
 Sequence can be extracted from the .2bit file with the <code>twoBitToFa</code> command, for example:
 <pre><code>    twoBitToFa -seq=chr1 -udcDir=. http://your-website.edu/~user/genome.2bit stdout > genome.chr1.fa</code></pre></p>
 
 <h3 id=extract>Examples of extracting sequences</h3>
 <p>
 See these series of blog posts about <a href="https://genome-blog.gi.ucsc.edu/blog/?s=programmatic"
 target="_blank">Accessing the Genome Browser Programmatically</a> to see examples of extracting
 sequences remotely, such as the following:
 <pre>
-$ twoBitToFa http://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.2bit:chr1:100100-100200 stdout
+$ twoBitToFa http://hgdownload.gi.ucsc.edu/goldenPath/hg38/bigZips/hg38.2bit:chr1:100100-100200 stdout
 >chr1:100100-100200
 gcctagtacagactctccctgcagatgaaattatatgggatgctaaatta
 taatgagaacaatgtttggtgagccaaaactacaacaagggaagctaatt
 </pre></p>
 <p>
 Also, see the <a href="api.html#getData_examples"
 target="_blank">API getData functions</a> to see examples of using the URL, such as the following:</p>
 <p>
 <a href="https://api.genome.ucsc.edu/getData/sequence?genome=hg38;chrom=chr1;start=100100;end=100200"
 target="_blank">https://api.genome.ucsc.edu/getData/sequence?genome=hg38;chrom=chr1;start=100100;end=100200</a>
 <pre>
   downloadTime:      "2022:05:19T18:45:56Z"
   downloadTimeStamp: 1652985956
   genome:            "hg38"
   chrom:             "chr1"