diff --git docs/tutorials/gb101.md docs/tutorials/gb101.md index 6b4fe5249c4..b4a85dbc9d9 100644 --- docs/tutorials/gb101.md +++ docs/tutorials/gb101.md @@ -1,322 +1,371 @@ --- title: "UCSC Genome Browser 101" --- This tutorial is a basic introduction of the most common UCSC Genome Browser usage. This includes the navigation menu, configuration of the tracks display, and where to find additional resources. ## Sections Explore each of the three section below to learn the material in a different form.

Browser Interface Annotated Screenshot

This 'cheat sheet' highlights and describes the main features and functionalities of the tracks display.

Guided Walkthrough

A guided walkthrough that explains menu bar navigation, as well as using and configuring the tracks display.

Interactive Tutorial

An interactive tutorial that covers the basic Browser introduction on this page.

## Annotated Screenshot ```image src=/images/gb101cheatSheet.png width=90% ``` ## Guided Walkthrough ### Navigating the Menus

```image src=/images/bluebarMenuGif.gif width=70% ```

The navigation bar at the top of the page will allow you to access our tools, downloads, and help pages. Several of these drop-downs are useful for most users: - Genomes - switch between the many genomes available. -- Genome Browser - configure, search for tracks, and reset the Genome Browser back to the default settings. +- Genome Browser - configure the display, search for tracks, load a Recommended Track Set, and reset the Genome Browser back to the default settings. - Tools - access to features such as [BLAT](/cgi-bin/hgBlat), [isPCR](/cgi-bin/hgPcr), and [LiftOver](/cgi-bin/hgLiftOver). The [Table Browser](/cgi-bin/hgTables) can also export track data in various file formats. - Downloads - download sequence and annotation data in bulk, along with our command-line utilities. - My Data - create stable short links ([Sessions](/cgi-bin/hgSession)) and visualize your own data via [custom tracks](/cgi-bin/hgCustom) or [track hubs](/cgi-bin/hgHubConnect). - View - save the current image as a PDF, get the DNA sequence for the window, or open the region in an external tool. - Help - access contact information, FAQs, and Browser Documentation.

--- ### Using the Search Box

The search bar allows you to navigate to a region on the genome using [genome coordinates](https://genome-blog.soe.ucsc.edu/blog/2016/12/12/the-ucsc-genome-browser-coordinate-counting-systems/), [gene symbols](https://genome.ucsc.edu/FAQ/FAQgenes.html#genename), [rsIDs](https://www.ncbi.nlm.nih.gov/snp/docs/RefSNP_about/#what-is-a-reference-snp), [HGVS](http://varnomen.hgvs.org/) terms, or DNA sequence. You can even search documentation and FAQ pages using this search bar. A few example queries are: - chr1:127140001-127140001 - SOD1 - rs2569190 - NM_198056.3:c.1654G>T - CCTTCCTATAGTCCGGAATACGCC AATGGCGCGGCCGGCCTGGACC ACTCCCATTACGGGGGTGTCCC GGGCAGCGGGGCCGGAGGCTTA ATGCAAAGGC Please note, [BLAT](https://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html#BLATAlign) is used if your search term is a DNA sequence. For the best results, make sure your sequence is long enough to meet BLAT specifications. The [examples](https://genome.ucsc.edu/goldenPath/help/query.html) link next to the search bar contains even more search queries.

```image src=/images/hgTracksSearchBarExample.png width=95% ```

--- ### Highlights and Zooming

```image src=/images/highlightZoomGif.gif width=100% ```

Dragging the Genome Browser image performs different tasks depending on where and how you click the image. Click-and-Drag the ruler at the top of the image will bring up a menu to zoom into or highlight the region. Click-and-Drag anywhere else on the Genome Browser image to scroll to the left or right. Alternatively, you can: - Hold **Alt+drag** or **Option+drag** to highlight - Hold **Ctrl+drag** or **Cmd+drag** to zoom

--- ### Configuring Data Track Display

Clicking on the rectangle box next to a track is an easy way to go to that track's settings page quickly. [Right-clicking](/goldenPath/help/hgTracksHelp.html#RIGHT_CLICK_NAV) on the track will also bring up a menu to change the display mode, configure a track, or view a PNG image of the current window.

```image src=/images/rightClickAndGreyBarGif.gif width=95% ```

--- ### Track Display Modes

```image src=/images/trackVisExamples.png width=95% ```

Annotation tracks can be entirely hidden or shown in four different ways that take an increasing amount of vertical space: [dense, squish, pack, and full](/goldenPath/help/hgTracksHelp.html#TRACK_CONT). *Pack display is the recommended visibility for most data types as it provides the best balance of information and space.* After changing a track's display mode, the change will not be applied until you refresh the page. You can either refresh the page manually using your web browser or click on any of the track groups.

--- ### Searching for Data Tracks

Having trouble finding a dataset for your genome assembly? The [Track Search](/cgi-bin/hgTracks?hgt_tSearch=track+search) feature allows searching for terms in track names, descriptions, groups, and ENCODE metadata. More information about can be found on the following [help page](/goldenPath/help/trackSearch.html). The Track Search feature can also be accessed by hovering over the "Genome Browser" drop-down menu.

```image src=/images/trackSearchSimpleExample.png width=90% ```

--- ### Configuring the Genome Browser Display

```image src=/images/configureGif.gif width=90% ```

Use the button to customize graphic font, size, gridlines, and more. This can be helpful when exporting an image for publication. You can also find a link to configure the browser image by hovering over the "Genome Browser" drop-down menu.

--- ### Viewing the Reverse Strand

By default, the UCSC Genome Browser displays the forward strand (5' to 3') but can be configured to display the negative strand (3' to 5'). To reverse the genome orientation, click the button, and the Genome Browser image will flip to show either the negative or positive strand.

```image src=/images/reverseStrand.png width=90% ```

+--- +### Recommended Track Sets + +

+ +```image +src=/images/recommendedTrackSets.png +width=95% +``` + +

+ +Recommended Track Sets are ready-made groups of tracks designed for specific +purposes. Each set turns on a specific set of tracks and pre-configures those +to aid in answering a particular question, such as interpreting clinical +variants. Choosing a set switches on the relevant tracks without moving you +away from your current location. + +Open the list from the **Genome Browser** menu in the top blue bar. + +

+ +--- +### Sharing a Link to Your View + +

+ +The **Share a link** button in the top-right corner turns your current view into a short, +permanent link that captures the assembly, position, and all of your track settings. The +link never expires, so it works well in emails, figure legends, and published papers. + +Log in first if you would like to give your links a name or update them later. To save and +reload a full setup of your own, use the **Sessions** tool under the My Data menu. + +

+ +```image +src=/images/shareLinkExample.png +width=100% +``` + +

+ --- ### Getting Help Using the Genome Browser

```image src=/images/gettingHelp.png width=40% ```

The [training page](/training/) has other guides and training videos. You can also search the [mailing list archive](https://groups.google.com/a/soe.ucsc.edu/g/genome) for previously answered questions. If you still have questions after searching the [FAQ page](/FAQ/) or [Genome Browser User Guide](/goldenPath/help/hgTracksHelp.html) pages, you can email the suitable mailing list for your inquiry from the [Contact Us](/contacts.html) page. Follow our [citation guidelines](/cite.html) when using the Genome Browser tool suite or data from the UCSC Genome Browser database in a research work that will be published in a journal or on the Internet. In addition to the [relevant paper](goldenPath/pubs.html), please reference the Genome Browser website in your manuscript: *http://genome.ucsc.edu*.